The mileage of a bike is a critical factor in the buying decision and also keeping our running costs low. Many of you think that mileage is just about the cost of fuel, but it is not. A bike which gives a good mileage compared to other similar bikes is a sure indication that the health of the bike is well maintained and the rider is careful enough to get the bike frequently serviced and tuned.
I talked with Sudarshan from Chennai and was surprised to know that his Hero Honda Karizma R gives a mileage of 41 in the city and 49 in highways. His bike is in perfect health. To keep the engine healthy all you have to do is, let the engine warm up before you take it to real performance. Small engines like that of Splendor NXG and Passion Plus have a horizontal engine, so as soon as the bike is started, the oil flows easily into the engine. But bikes with a high bore and stroke find it difficult to circulate the oil throughout the engine as soon as it is started.
Sudarshan recommends bikers to put the choke, self start the engine and leave it for 10-15 seconds so that the oil gets heated up and the luke warn low density oil finds it easy to circulate through upto the top of the engine. Do not leave the choke for too long as it would flood the engine with fuel. Do not open the throttle until it has run for atleast 5 km distance and the engine comes to a normal operating heat range.
If you gun the engine in cold conditions as soon as you start it, there would not be enough lubrication in the engine and it leads to more friction which ultimately damages the piston and the engine and hence your mileage will be low.
If you go to a gym, your coach will ask you to warm up before you do some heavy lifting and iron pumping… this is just like that. Your bike is not much different from your body!
Another good tip worth mentioning is to remove the saree guard if there is no use for it. I am a student and even after I get married I do not expect my wife to sit on the high back seat of Karizma… I would be probably getting a free car as a gift at that time
. So I removed the saree guard as soon as I bought it. It reduces dead weight by 4-5 kg and would definitely improve the performance of the engine and increase fuel efficiency.
Some basic fuel efficiency tips that you may have already known are 1. Switch off your engine during signals with long waiting periods. 2. Change your oil according to your manufacturer’s recommendations. 3. Check your tube’s pressure every month… higher pressure than the recommended value would give you more mileage but less friction and stability. So keep it to the optimum value.
I am interested to know what kind of mileage your bike gives. Post your bike model and mileage in the comment below and let us see who reports the highest mileage!
Share on Facebook

{ 660 comments… read them below or add one }
i have a karizma it gives me a mileage of 42 in the city have not checked it on the highway but the speed at which i generally drive i dont think its gonna be a lot.
and i agree wid this cos i do the same thing before i start my bike.
Hello Deepak,
First off Happy Dipawali & A Prosperous New Year To You..
I am quite interested in keeping myself updated in the Motor world; so I got your RSS hooked up on my email resulting in receipt of your latest reviews and tips regularly. I would like to share my comments on the bike I own :
Make : Bajaj Pulsar 150cc
Model : Nov-2002
Luckily my bike is in very good condition and it gives me mileage of 55-58 Kms in city and 60-65 Kms. on Highway; which I know is very good for a bike with 150cc.(Please correct me if ‘Am wrong.)
how is it possible i hv a pulsor of 2003 model with 180cc n it gives hardly 25km/ltr
Hey
Same here – my bike is 2003 model and gives average of only 25 ;-(
it is according to hw u handle ur vehicle… If u raise the acceleration in low gear it will consume more petrol and reduce mielage
Hey Anil,
can you share some tips
i have Bajaj pulsar 150cc and model 2011, then also not get more than 42KM/Ltr.
Hi,
I have pulsar 150 Feb 2003 model. My bike still gives me average of 50-55 in city and around 60 in highways. I regularly get my bike serviced at authorized bajaj service center and nothing else. I drive at the max speed 60 in city and 70 in highway.
Regards,
Arunda
Hi Chandan,
I have a June 2011 P150. Odo indicates a mere 3500 Kms as of now. Since I bought the bike, I
have touched 100+ speeds a couple of times and rode in the city for the majority of the
times. I am getting a regular 57+ KMPL since its birth. My usual speed is 40 KMPH and I
don’t know if its advisable, but I short shift.
1st gear – 13KMPH
2nd gear – 22 KMPH
3rd gear – 30 KMPH
4th gear – 37 KMPH
5th gear – 42 KMPH
and then I happily settle down for 37-44 KMPH for the whole duration with occasional speed
increase to 60-65 KMPH. Since I was unhappy with the behaviour of Bajaj’s mineral oil, I
have recently switched to Yamalube Semi-Syn 15W50.
Hi Anil, thanks for keeping up with my RSS email subscription. You have got great figures with the bike, keep it up. I have posted your question in the forum and answered it there.
Let this post be reserved for the mileage.
Hii i am regular reader of ur articles. i have subscribed RSS to my mail ID. they are very useful esp the bike reviews.
I own TVS Victor GLS model. some 5 years old.
it has done 33,000+ KM and gives me 55/58 KMPL. i guess this its less. my driving is normal, but when i get late then i drive roughly so that causes more petrol.
thank you
hi….i m ur regular reader and i enjoy ur articles…..and i m very thankful to u….. after reading ur this article as i m driving as per ur recommendations…..i drive bajaj pulsar 180cc and it gave a milage of near 43km/litre…….and i m very thankful to u….keep posting me ur tips for maintainance of pulsar 180cc
give some tips
I have Karizma. And I am very happy with it. It is gradually increasing it mileage. It started from 33 and now it is 37. When I used to fill up the entire tank and check it used to give me 34 but I am checking it fuel worth of Rs.500 it is giving me 37. Is it any factor i mean the amountof pertol in the bike. And also thanks I seriosuly appreciate the tips heer and also will appreciate more.
hey thanx 4 the tips…i own a bajaj discover 135 dts-i…….it gives me a mileage of around 55-58kmpl in city and 65-70kmpl in highway……..actually i ride the bike at 50-60kmoh thats it….
How r u maintaining a mileage of 60 kmpl..my discover135 cc gives a mileage of 45kmpl..m.please suggest me sum useful tips
I have a Honda unicorn150cc it gives me 28 in the city and 35 on the highway.how can i take more mileage now?
speeds please
Follow the tips .. If ur engine is not too old you wil get a mileage of 55kmpl average frm unicorn. I get 64 maximum in highways and 44 min in local roads. Kerala.
Hi Deepak,
I am a new subscriber, i found it very interesting and whish to know more , bcoz. my bike knowledge and experiance is only of few months.
i bought a Pulsar150 DTS-I on march of this year and i am very unhappy with the performance of my bike. Its mileage is around 45-48. I have taken the atmost care, i have got all the services done well before the mentined time fearing of the drop in mileage.
Following are my regular riding practices;
* I start early to office, around 5:30am, I kick- start and throttle moderately until its ready to move.
* Ride at max. 10kmph in 1st gear, 15kmph in second, upto 25kmph in 3rd, upto 36kmph in 4th and above in 5th.
* Go consistently around 46-50kmph.
* Have reached 85speed only once for few minutes. completed 7500kms with 4th service done
I feel rigid in shifting the gear although i lift with my foot (instead of pressing with the heal), the engine also gives a weared sound and maneauring is not that comfort.
sorry for making you bored by long list of faults in my bike.Its my first bike and i love it a lot, but i found the bike dealers useless in guiding me.
“I will be happy if Anil and yourself would help in getting my bike to proper working.”
Lokesh, I was using pulsar 150 2004 model. I bought it in seconds. speedo shows 17k done when I bought it. and thats my first bike.
It gave me 60kmpl weather on highway or in city. I got no idea why its always the same.
after couple of months and after some services with my local mechanic; to my biggest suprise and shocking is that my bike gave me 80kmpl and about 7 to 8 times I thought I lost to check it properly and corrected but I always gave 75+. unfortunately met wiht an accident and lost all its good mileage.
My idea and what I heard from friends:
Bajaj lost its quality from the first bike pulsar 150 and the present P150.
any how I never like driving my friends vehicles so I personally did not experience it. Now I am using P220 and its mileage is 47kmpl when I was in hyderabad and now its down to 35 in city and 40 on highway (now in vizag)
and the only reason that I beleive to have a drop in mileage is because now in vizag I hardly ride for 3 km. In hyd I used to ride to my office 10km and back home 10 km.
heyy…. yr actly ur rpm is too low….!! for the shifting of gears….it must be upto 15 for ist gear….25 for 2nd…35 for third….45 for 4th and so onwards….. low rpm leads to tubulance and low flame velocity in engine……. too low rpm (which might be gud for 100 cc bikes) can lead to ur engine failure….
Hi recently i subscribed to bike advice really finding it interesting n useful i’m having suzuki 150 fiero of 2001 model mileage is only 35km, lots of electrical problems,engine noise,n also not serviced 4 since past 3 mnth kindly suggest good mechanic between andheri 2 malad tvs service centre is proving 2 b vvvvvery expensive.
thnx
Hi i have a 2005 model of Hero Honda Super Splendor
It has clocked 30K km till now, before my first service riding at 40-50 km my bike gave me 69kmpl mileage with mixed city and highway.
Now it returns just 50-52 km in city’s don’t know about highway. I am slightly on the speedy side of riding habits so i am satisfied with it, but i think my bike mileage is poor in highway. Is that an issue?
i’ve bought by apache rtr fi this diwali.. i dono watz d exact mileage of this beast.. but i guess itz giving around 42 kmpl.. wat should i do to get good mileage.. can u tell some advice in gear shifting.!
hi. I own an apache too.
1st gear upto 15
2nd 15 to 25
3rd 25 to 35
4th 35 to 45
n 5th frm there on.
Riding in 5th at 40 to 47 gave me an avg of 53 once. Constantly above 45 otherwise. Only once it gave 38 n that was before 1st service. Happy riding.
hiii…!!!
model:passion plus(2005)
i have a milege problem my bike gives the milage of 25 to 30….which i think is very low so can u jst assist mehow can i increase milage…!!!
thankssss..!!!
passion, 25-30kmpl. you might have mentioned the speeds at which you are riding..?
Hi
Deepak i am new to this site but after reading all the post.
i just wanted to ask you that i am planning to to take a bike little bit confused with some of my options are…:-
1) RZ-16
2) Avenger
3) Pulsar 150 DTSI
what do you think which is good in performance and maintenance as of now i ve TVS victor which gives a mileage of 55-58 Km.
heard RZ-16 is doing gud not sure of he mileage
My requirement is a good loking bike , which gives a mileage of 40 or above , and reuire less maintenance…….
Can you help me out….
hi harsha
iam also a karizma owner.when you fill petrol dont fill more than 15 litres in your karizma’s petrol tank.the karizma has a fuel tank capacity of 17.5 litres but the company specifies to fill only upto 15 litres.
also use only normal unleaded fuel for the karizma no power or xtra premium or speed brands of petrol. make sure you fill from a company operated petrol bunk as the quality,purity and quantity will be optimal.
yes you are right as the more petrol you fill the more the pressure and it might increase fuel consumption but this is not properly proven so it may not be the case of difference in average of your bike. there could be other factors that are influencing the average of your bike.
the karizma gives 40 in city and 50 on highway but we must understand that such figures are dependent on fuel quality and quantity, bike’s health and condition, load and road conditions, traffic, tire pressure and a host of other factors as well.
do you get your bike serviced properly from an authorized hh workshop. the company only gives rough guidelines of getting the bike serviced every 2 months. this schedule wont apply if the bike is used more in terms of running or in dusty conditions. the bike’s engine oil and additive oil called ezi oil need to be changed according to the usage.
the company specifies to topup oil every 2000 kms and change oil every 6000 kms but the usage will depend on the frequency of your bike’s oil change and additive changes.
so think and try to find out what could be the problem in your bike. my bike gives me 41 in city and 49 on highways.
i change the engine oil every 2000 kms and add the additive ezi oil every 2000 kms. i do proper warming up by idling the bike for 5 minutes each and every time i kick start it i dont give any throttle at all. i employ the choke for a 10-15 seconds and after which i let the bike idle on its own without giving any throttle and revving up. my bike is serviced at chirag auto where there is a karizma specialist and he is the only person who i trust my bike for servicing and no other mechanic or service center.
so use and maintain your bike properly and it will serve you superbly and also give great fuel efficiency.
find out all the things which might affect your bike and if still the mileage doesnt increase post a message in this section and i will try and find out a solution for you.
hi lokesh
if you want to find out more about bike tech stuff why dont you call me and i may be able to help you out as i cant post everything on the site and certain problems need a personal touch.
1. the problem i see in your method is giving throttle to your engine when your bike is cold at 5.30 in the morning. you see the pulsar has a vertical mount engine and the engine oil takes some time to heat and properly circulate through out the engine.
what you should do is before you start your bike put the petrol to on or reserve position according to quantity of fuel in your bike. put on the choke and keep it open, now open the throttle many times so that petrol enters the engine, close the choke and again open the choke and keep it on and again open the throttle a couple of times. now kick start the bike and leave the bike on with the choke for 15-20 seconds. dont give throttle once the bike is started. close the choke after 15-20 seconds and let the bike idle for 5-10 mintutes but atleast 5 minutes minimum is must with out giving any throttle at all. after the warming up drive the bike slowly and dont gun the engine by giving excess throttle for the first 5-6 kms. after the bike has run for 5-6 kms the engine would have heated up and the engine oil heated up to the proper circulating heat range.
2. it seems that you are changing the gears before hand and this is hampering the bikes pickup and loss of performance. every bike has a proper sequence for gear shifting and this has to be followed.
you must try and understand that a bike must not be over revved in lower gear or go below a certain speed on a higher gear as both will damage the engine and result in loss of performance.
i suggest you drive in 1st upto 10, 2nd from 10 upto 20, 3rd from 20 upto 30-35 km/hr and shift to 4th at 30-35 upto 40-45 and 5th at 45 or 50.
every bike has a proper functioning speed range and limit and one must try and develop the knack of extracting the maximum from your bike without harming your bike.
if you still feel you need more help call me at 9941338179 i live in chennai my name is sudarshan and a good friend of deepak raj.
Hi i am Tejaswin Iam living in B’lore i have pulsar 150 black 6months old .. i am getting a milache of 38 wear as my friends are getting as 45-48 kmpl i kick my bike in morning 6:00 idle for 1 min and later drive it … my gear shifting technique is
1gear-0 to 12
2Gear-12 to 20
3Gear-20 to 28
4Gear-28 to 35
5Gear-35+
i ride in city usually at 50kmph
i service my bike regurlaly .I have completed 4400km i put oil every
1200 km but im not happy wit milache it give …….i complained to the dealer changed the oil stump but no improvement in milache i tried putting SHELL petrol but the increase in milache is only by 2kmpl
Please tell me what to do to increase milache and i am planning to put k&n filter can it increase the milache
dear tejaswin,
gear shift pattern is not ideal for every bike. the shifting depends on bore/stroke ratio or RPM of bike. so for your pulser,when the RPM reaches 4,shift up. when falling below 2,shift down. you will definitely observe the change. Of course the ride also be fine.
Hi m kaleem, i ride passionplus 2005last month model…I dont have a outmost knowledge of bike tips as i riding 4rm past 5months .I dont have a maximum usage of it except 4 a 30 2 50km per day .Plz provide me the tips and tricks 4 better milage and performance..
hi tejaswin
try to get your bikes carb properly tuned may be the carb and the fuel settings are causing the problems.
does your bike have the correct idle rpm during idling check for the proper idle rpm from the owners manual and see if the bike has the optimum idle rpm.
put fuel from a company operated petrol bunk and stick to one good petrol bunk. use only normal unleaded fuel as the pulsar has to run only on normal unleaded petrol. dont fill fuel more than 15 litres of fuel in the tank.
has the engine been properly tuned during the pre-delivery inspection and during each of the services , the engine can be tuned for performance or fuel efficiency or the stock setting. i suggest the bike has to be in the stock setting as it would give you the max benefit in the long run.
if you put a k&n filter you will lose the warranty, the performance filter will make the engine to breath more freely as the airfolw would be more this results in the bike having more power and pick up. mileage will definitely come down by 10-15 km/ltr.
is the service center you are getting your bike serviced have experienced staff and are they doing their job properly during services, are they carrying out the jobs specified by the company with meticulous precision mentioned by the company. failure to do so the bike’s performance comes down.
the pulsar gives a mileage of 50 in the city and 57 on the highways. do you rev your bike or gun the engine when the bike’s engine has not run for more than 5kms. by doing so the cold unlubricated engine’s valve will experience more wear and tear and might end up bent. you can identify the engine’s wear and tear by allowing your bike to idle and hear the idle sound. if the sound is not smooth and the idle sound has a coarse ruff sound like gatagatagatagatagata then your engine has taken a beating and needs to be worked upon by changing the valves or other parts affected. a drop in mileage is the first sign that your bike’s engine health is not optimal.
use the company specified engine oil. try to get the engine oil changed completely for the 1st 6 services. as the metal parts rub against each other and there would be more friction and less lubrication. the new engine will get heated up more quickly and the engine oil would lose its viscosity and lubricating power due to the heat and friction.
try all these tips and let me know.
hi… i’m riding an RX 100 (yamaha)… it gives me an average around 30kmph…. i have no idea what it shud give actually….
another thing i would like to ask is abt buying a new bike… i’m planing for the new yamaha FZ 16… is it worth it…. i mean whats the avg and would it be fine for a city like bombay…
hi fayesal
please go ahead and buy the fz its a the best decision you have made. the fz should give you a minimum of 40 under normal driving conditions in city. make sure you dont gun the engine too much and dont drive the fz rashly. one of my friends tells me he gets 40+ average in the city. the fz will definitely give anything between 35 to 41 in the city depending on your driving style, roads, load, traffic and sorroundings. but anyways go for it, its the best 153cc bike in india and a worthy replacement for your 2stroke exotic the legendary rx100.
hi fayesal
your rx is giving you a good mileage for its power, age and pickup its ideal mileage. the fz is the best bike for the city use its very accomplished for city use. like i said go for it.
Dear frndz
where all od u’ll have writen abt ur geared bikes, i would like 2 tell u abt my non-geared bike
Model:-Honda Activa
Year of manufacture:-2003
displacement:-100cc
my average speed is 60+
top speed:- 90-91
AND MY MILEAGE IS 40 KMPL
now which do u think is better,nd neither do i follow ur above rules
so dude wana race??????????????????????????????/
yes pulsar 150cc
hi i own a hero honda karizma r n my bikes fuel efficiency is:
city= 40kmpl
highway= 53kmpl
the idea behind getting high mileage in city is to run the engine in top gear 3-5 as far as poss the more the top gear the more is the mileage..u have to attain this by shifting gear as soon as ur tacho needle ticks 3000rpm for every gear…try n c the results…also correct tyre presuure,braking,preventing sudden throttle,way of changing gears,not keeping bike under direct sunlight would add to it
I have own Pulsar 150 DTS-i Purchased on 14th October 2008, Till now it gave me a 58-60 Kmpl in the City and 62-65 on the Highway i have checked by myself and by my friends itself and they said that it’s your luck that your engine may be best made by bajaj productions……..because i have heard from some of the people that it gives only 45-50 on highway as well as on the city….but believe or not it’s true for me….
Thanks for your tips…
hi, Amit Prajapati,,
will you pls tel me some tips to increase my bike average[pulsar 150 cc,(2005)]..it gives me only 25 to 30 kmpl..
Hi Deepak,
This is the 1st day I am reading your reviews…………its good and very useful tips that one has to know. I am having a Royal Enfield Thunderbird Twinspark which gives me 43kmp/ltr in city and I have not tried it in highway as I have not completed its running-in.
hi champ
thanks for sharing great tips dude. even i have a karizma r and i get 41 in city and 49 on highways
“even i have a karizma r and i get 41 in city and 49 on highways”? What are you talking about Sudarshan, it was you I was talking about in the post!
hey ppl….
im buyin a bike early next yr, probably jan second week…i have short listed to either FZ16 or p200… im bit of a rash driver… love zippin past da traffic.. mileage s a main factor for me cos i drive around 50 km to coll daily. i wud like to know da better option… da prob i find wid FZ s tat its not for highway… goes pretty quick till 60 then drags it all da way to 70.. p200 dominates here… so ne chances of gettin a 50km\l on it !!!!!!
Hey Freak,
If you are a rash driver, you should not be so concerned about the mileage factor. But w.r.to your decision b/w the two bikes. I suggest you to go for pulsar 200, as it has got a good wide tyres and a superior braking. Don’t worry about the mileage as in long run it would be equalized. My humble request for you is to rash your bike after top gears which gives you good mileage when compared to rash driving the bike within the top gear speed.
thanks man… i ll keep tat in mind… n by da way i think da FZ has broader tyres…
hello im sathish,iam a TVS apache rtr160 owner,my bike is giving only 40-45,can i improve my mileage guys,any one help me
Hi,
I am using Apache RTR 160, I have put K&N air filter from the day i purchased the bike and I haven’t felt any difference in pickup or in the mileage, could you please help me giving a suggestion what could be the problem in my bike.
Mileage is about 38 to 40 km/p.
hi satish
the apache rtr has an oversquare engine so the mileage your getting is good for the city use i dont think the apache will give more than 45 in city use.
hi navaneeth
the k&n filter makes the engine breathe more freely so the mileage you are getting is good may be the bike can give you 40 but thats about it, your bike will have more pickup and slightly more power than the other stock rtr’s drive any other rtr so find out the difference.
k&n filters are high performance filters so 38-40 is a good mileage in my opinion considering the rtr has high revving oversquare engine.
and dont adjust the tuning let the company settings be as it is to ensure the engine has longer life
hi
I’m zakir from bijapur (karnataka), I have HERO HONDA SPLENDOR PLUS bike 2007 model. my bike is not giving sufficent mileage compare to other same bike’s from 2nd service to last free service(that is 6th) in showroom i complained about worst mileage & said to increase mileage of my bike but till now my bike is not giving more then 45-48km per litre. so plz give ur advice .
Hi,
I am Pravin from Mysore and I own Apache 150cc. I get around 55 km/l
I drive in the economy mode 40-60km range maximum. I am planning to fit it with K&N filter R-1060 as my friend suggested that it would increase the mileage
Hi
I’m from b’lore…
I own a honda shine…about 6 months old…It has been serviced thrice…but i get a mileage 35-40!!! I don’t understand y…My driving is pretty smooth, accelerate smoothly, don cross 55…And I mostly drive on d highway…but still d mileage is pretty poor…
Please help…
hi iam from Jodhpur..i own a bajaj pulsar 180 dtsi..its 6 mnths old…its givin a mileage of 42kmpl..i dn ride very roughly…n generally dn cross 50-55kmph…is my bikes avg good enuf??plz reply…n ya i wntd to know if i cn fit a pulsar 200cc silencer in my bike?hw much wil it cost?plz help
Hi, I have Honda CBF Stunner 125cc bike. Honda Unikorn, a 150cc bike gives consistent 55-58 Km/lit mileage in the city, so, I thought Stunner will definitely give me 60-63 Km/lit mileage as it is an 125cc bike. But its just delivering 50 Km/lit. Why it is so?
Best Regards,
Nikhil
hi iv got the newer model of the HONDA DIO .Its been 3 months since i bought it !! it gives a mileage of onli 33km/l which i think is little! cn u advice me on how to increase the mileage
thanks
Hello Everyboby,
I have Pulsar-150 bought 1 one month back.
My question is what is the right time to check your new bike mileage. I mean should we check it after 1st servicing or may be later??
i”m also getting below 50 for stunner
Hi sudharshan I am rakesh & i own a supplendor+ bike which i had purchased Four months earlier. which had covered distance of 1100 KM & serviced once on 600 KM on auth. dealer. I used to go office daily on my bike which is around 8 km away from my home in delhi So always my bike cover short distance.First i put choke & kick start my bike & leave for 10 sec. then i used to idle for 1-2 min. & move bike 1-2 km on second gear or third with speed 20-30 then i ride with speed 40-45 in top gear never crossed 50 km/h I changed 2 gear on 10 3 gear on 20 4 gear on 30
The bike give around 60 km/l average in city with covering only 6-7 km in one strech sometimes even 2-3 km only. i think my bike is under performing as it should give 70 km/l can u tell me what mistakes i make & how to improve milage or the bike is giving good average
One more think i used to clean bike with a cotton cloth daily & wased it
in 2 weeks with pump should i use anu lubracant for chaim lever & other joints & use wax on body please suggest good lubricant & wax thanks in advance
Hello sudharshan,
I am Ratheesh stays in kalyan. I bought Honda Shine in november. I always have to give choke during cold start is it advicable as you have suggested above.
Also after 40km/hr bike vibrates, is this because there is further room for engine and gear to smoothen or is it a drawback of the design of teh bike. Please do suggest me on this and how can i reduce this vibration. Is there any specific or better engine oil that can help reduce vibration and starting problem. One of my freind did suggest me add-on lubricant that smoothens the gears and increases the mileage.
I was able to touch 80km/hr and was in control and balance. i am planning to test further its limits after it crosses 2000km.
Otherwise the bike performance is really good. Eccept i feel is the bike continues to vibrate it might cause future problems for maintainance.
Plz advice.
hi,
I had a honda dio,it is good moped but it gives average of 45km/pl.advice me to increase its mialage upto 55.
waiting for help………..
have u got any reply please give me information about dio mileage improvement.
hi guys ,
i brought a new pulsar 200 3 month ago. it has all in it. but the mileage i am getting when comapred to others is 33 in city highway yet to try. i am pissed off with this.i dnt drive rashly. can u guys suggest wat the prob with this. how to increase my mileage.
Hi this is Sandeep S,
I own a Passion Plus bike which is 2 yrs old. It gives me an average of 40km/liter, am not satisfied with it. I expect atleast it should be above 55km/litre. How can i improve it?
Kindly guide me, thanks.
hello deepak
i ve decided to purchase a new bike
i want bike in cool style , good mileage ,
can u sugest me stunner is good or pulsar 150 or apache
i would like to buy a bike. i specified following. which one be best & give more mileage.
1.suzuki GS150R.
2.Pulser 150
3.CBZ Extreme
4. Yamaha FZ16
hi jeyakumar please consider apachertrfi sweet bike in the above list go for fz16
Hey sudarshan,
Thanks for sharing with regards to mileage. I recently bought Thunderbird Twinspark and it gives 40 km/per litre approx. I just have one question wil the mileage wil get affected if we frequently use the clutch like shifting the gear in a short span of time ??
thanks
I have a RE Thunderbird. I need to change the silencer which will give me a loud thumping sound of a bullet without degrading the mileage. I get a average of 35 to 40 km per litre. Is there any way i can increase the mileage.
Enticer – 115cc
16700 kms
Mileage 35kmph with unleaded, 39-40 with premium.
Will try your advice for a couple of week track it again
hi,
my name is sandeep n ihv bought a pulsar 150 2003 model how to increase its milege its mileage is around 45KMPL n its accleration is more due to that reason its crating a lot of vibration my bike topspeed which it is giving nw is 120 it starts vibrating at 90 socan u please suggest any………. n one thing i also want to increase the beat volume in my bike with out decreasing its mileage u can advice me about that also k waiting for ur advice
hi,
my name is sandeep n ihv bought a pulsar 150 2003 model how to increase its milege its mileage is around 45KMPL n its accleration is more due to that reason its creating a lot of vibration my bike topspeed which it is giving nw is 120 it starts vibrating at 90 socan u please suggest any………. n one thing i also want to increase the beat volume in my bike with out decreasing its mileage u can advice me about that also k waiting for ur advice
Hi,
I own a Apache RTR and it provides more than 50 mileage in city.
I’m Anand and i own a Pulsar 150 2008 model. I get to run for 48 to 51 kms within city and 58 to 60 on highway.
I’am abishek i have a bike yamaha gladiator type rs.it gives 62kmpl milage
i have a hero devil bike.i don’t have mileage problems because it does’nt have an engine.i can go as far as i want with out spending on petrol.it’s eco’friendly.it helps me keep fit.so fuck all u bike owners’
Hi,
I own a FZ-16(black) which is 5 months old……in the begining it gave around 37kmpl in city ….but after two servicings, it started giving a mileage of 41 in city and 46 on highways……..i personally feel its still low on mileage can u suggest any fuel efficiency tips to increase my bike’s mileage
hello guys,
i’ve yamaha gladiator SS
it has done +5,000 kms
it gives me an average of 50-55kms/litre
i always ride at 60-70km/hr since i’m going to my college which is 15km form my home
i’m happy with the performance, comfort and unbeatable braking system that yamaha has.
Hi!
would like to share some of my experiences with mileage
I own a Pulsar 180 UG3 2007 model
It gives me 57 km/l with 120/80 modified rear tyre and mixed city riding
It drops to 41 to 44 km/l (speeds 70-110 range)
To derive the max out of ur engine drive at a constant speed of 45 to 50, this is where the economy zones works and be patient in initial pickups at signals etc. Thanks.
dude i cant blv it…my Pulsar 180 UG 3 is giving just 45kmpl…i ride at a constant speed of 45-50…the company claims 50kmpl…hw cn u get 57 kmpl????have u made sum other changes in ur bike?plz do reply asap…
I have a SUZUKI SAMURAI. The no problem bike. gives a mileage of 37-40 in traffic and 40-43 on highways. I got it second hand bike and in 13 yrs old.good engine beat. is the mileage good or can b improved???
I have purchased passion plus in oct2008. Before 1st servicing i was gettign an avg of 50. Afetr giving the bike for 1st servicing my avg declined from 50 to 40 and finally. i visited the service centre and still teh prob persists. Iam still getiing 40avg. I drive my vehicle at the speed of 45-50 on highway and use the spped as specified on the spedo meter regarding changing of gear. I am really feeling at loss of money for petrol. I dont hav any other issues but the only reason i purchased this bike is for mileage or i would hav gone for pulsar. pls help me out.. what to do to increase the mileage
hi everybody
this is harsha from hyderabad, i have honda shine bike which gives a mileage of 62-64 KM (at Avg. speed of 50km) in city but when i go for a long drive i.e, out of station my mileage is decreased. can any one help me with this…
hi everybody,
this is harsha from hyderabad. i am having a honda shine ( 2008 model. it gives a mileage of 62-64KM (at an avg. speed 50km) in city. but when i go for a long drive my mileage is decreased. can any one help me with this please. my id is harshavardhan42@gmail.com
HI dudes good to see the tips of getting the Averages
First of all I wish to mentioned that I own four bikes
HH Karizma R—————Avg-42 city,52+ highway
HH CBZ (old model)———Avg-45 city,53+ highway
HH Passion—————–Avg-57 city,65+ highway
HH Splendor (Basic model)–Avg-65 city,70+ highway
But I surprise the conditions when full tank of Karizma gives me average of more than 50+ in city , and 57+ highway
This will improve my Karizma average then I try it to all bikes and ya this will work and i get average improvement abt 10+ on every bike.
The idea of run the bike
1.average Speed ——55-60 for karizma, 45-50 CBZ,35-40 passion and splendor.
2.Choice the right gear and increase and decrease the gears on right time.
3.Maintaining accrurate tyre pressure.
4.Chain of bike should not be tight or loose.
5.Right time to change the engine oil.
6.Proper Servicing.
7.Breaking should be checked , specially in the case ur bike having disc break , beacause sometime disc break little contain friction because of dust/mud and this will choak the bike flow and decrease the average.
4.Make sure ur petrol pump provider provide u the accurate fuel and clear fuel(some petrol pump provider contain fuel with mixture of things in petrol, damage ur bike engine and average).
Thanks to all for wonderful tips enjoy.
Hi harsha ,
I got ur problem
actually what we do is that in long run increase the speed of bike which causes more consumption of fuel and decrease the average of ur bike.
The second reason is that you have to cool down your bike in aroun 75km run in once so that engine takes rest and ready to burn fuel at the efficient terms.
Thanks
HI SUDARSHAN,
I M IN DILEAMA WHICH BIKE TO BUY? LOOKING FOR BIKE OF 125 CC WITH GOOD MILEAGE. CAN U HELP ME TO LOCATE?
hi deepak
i own a fz 16 and after 1st service i got mileage of 44+ and now after 2nd service its only 35 maxmium wat 2 do with such problems? plz help me out
Don’t worry Ram. Check the mileage for another few times and let the numbers average out.
ride it at an average speed of 110kms/hr then surely u wil get a pleasnt average
Dear Friend,
I have some small suggesstion…
Sorry for that..
I have Honda Unicorn and 180 Pulsar..
I Use to put Shell petrol..for my both bikes..
after over period of time bike started making noise in the engine in both bikes..
I have cross Verified with mechanics and service centers they are telling the same..
I love my bike so much more than me..
Now i am using Normal Petrol..
Only Unleaded petrol other than Shell Bunk..
MY ID : pkk_kunna@hotmail.com
hi plz tell me everything about the bajaj discover135cc dts-i its power , comfort and the most important thing also teel me about its breaking system . u know i love the bikes in disk breaks. and on the discover at what speed applying the front disk is safe.
Hi Discover owner..
It’s Cool Vehicle…
Bajaj bikes will listen to sigle hand users only..
dont give the bike for rides for anyone for long drive and all..
dont doo the Whelee so often..
Mileage is pretty fine 60+ for the decent drive in city condition..
Dont drive fast so often chasing with that bike since it’s light weight bike it wont listen for our sudden braking unless u are confident about braking..
Always use 60% front brake and 40% Back Break for better braking.
While doing fast drive use 50%Front 50%Back braking that sounds good braking..
Always dont trust bike more then your confident..because tyre pressure,road condition are important..
use the braking accordingly.
Apply slowly not sudden brake..
other wise the bike is really great and smooth
always get the vehicle serviced properly..
hi plz tell me everything about the bajaj discover135cc dts-i its power , comfort and the most important thing also teel me about its breaking system . u know i love the bikes in disk breaks. and on the discover at what speed applying the front disk is safe.
MY ID: s.ramanbir@yahoo.com
Hi Guys,
I am going to get my first bike of my life n that is Karizma Black this weekend. As i have not driven any bike much in my past, i have few queries to ask. It would be appriciable if any one of you can give me right feedbacks:
1. Some people say that karizma skids while applying breaks all of a sudden. I would like to ask that in heavy traffic, how good is the control of a Karizma?
2. As there are no leg-guards in karizma, should i get it for safety or is it ok without it?
3. What is the throttle and how it is used while driving a bike?
4. Which helmet i should buy that will compliment karizma black?
Cheers!!
I own Yamaha CRUX 2001 mode. It gives me @ 50 Kmpl average. I am intrested in some suggestions to keep the engin performance better. Apart From regular oil change what are measures / tips that can help to improve or maintain the engin condition.
i have yamaha fz16 2008 model. i drive it about 5000 km but it give 32-35 km/pl in city and 35-38 on highway
pls suggest me how to improve
i also have this problem yamaha fz 16 does not gives more than 35-36 km/pl
i have hero honda splendor+ 2008 model. i drive it about 9000 km but it give 40-42 km/pl in city and 45-48 on highway
pls suggest me how to improve mileage
hi friends
I got new CBZ extreme2009 model
what is initial speed of first 1000 Kmts
pl suggest
can anybody tell me excatly how to cal the mileage? i ve owned Gladiator ss.
hi sir
u told about the warm up process between bike and a guy in gym for the best mileage it was really a good explanation and i jus wanna know 1 thing is that this should be done every time i start my bike or starting for a first time in the morning? pls help me
Guys,
It looks like we have pile of questions and there is no answers coming from experts.. ?
MODS / Thread owners / BIKE EXPERTS can you please post answers ?
Regards,
Mayuresh
Only in the morning you can warm up your bike……
Then every time you start the bike wait for 10-15 seconds and start biking…..
Have a nice riding…
Answers expected…
I read all the queries expecting answers from experts…but nothing.
There was a query regarding fitment of scilencer of 200cc Pulsar to 150cc old Pulsar…
The same is with me…
But there was no reply….
PLease do reply…..
hi friends one day before i purchased new cbz extreme ATFT, but my bike is idling at very high rpm(3000) i know it is correct. but some of my friends told me that in case of new bike mechanic set it high after that he will tune it to 1400rpm(ideal idle). is it so?
one thing more when i turn my kick lever in kicking position (when vehicle is already ON) i sounds KIRR KiRRRR. why?
is there any problem with my bike?
plz sort it out.
read Very high rpm(3000) i know it is not correct
hi guys i am frm hyderabad, i am riding a passion plus red colour. i never go below 70kmph on highways. i drive it very rash. even then i am gettin nearly 50 mileage in city nd 55+ on highways. i travel a minimum of 30km daily. it has completed nearly 18000km in 1 nd half year.
hii sir i have apache rtr 160 cc.
and i got an average of 35-37.
how can i get good average on what speed i will drive my bike.
pls tell me.
thanks!
Hiya Vinod here living in kochi, I hav hero honda ambition 133,it is 6 yrs old now, in d initial stage it gave me 54kmpl bt now m gettin jus nearly 34-36. I jus want to increase milage of my bike.Plz giv me some tips to increase milage…
vinod
Iam using Discover 135cc (Black w/Blue line sport type model) for the past 16 months…I haven’t faced any problem till now…really wonderful bike…I gives mileage about 54+, if you drive <60 Kmpl…otherwise 45 to 48 only…Overall it's good bike for all….(youth, middle age & bit old people)….
hei i have pulsar 150?
n on highway it gives above 65 average and in city it gives around 42?
ehat to do
Hi deepak …
I own a hero honda super splendor since 1 yr … my bike has clocked 3024 km … the problem is that my bike gives me a milage of only 35kmpl ….. I think this milage is very low … I m a speed freak !!! so i drive my bike at a speed of 60-80 kmph … Please do answer my question i am waiting for your response ….
drive ur bike at a minimum speed of 50kmph,apply less brakes,and drive your bike smoothly… this is it
hi,
i have a fz16 on the highway its giving avg of 27-28 and in th city its givin 32-35. which i think is vry low. i drive my bike at a speed of 90-100 kmph on highways by not shifting th gears much….pls advive me hw to incerase th milage…
rizwan shakil
just go between 45-50 km on 5th gear and install a k&n filters so the bike gets more breathe usually it increases mileage and prfomance
thanks
Akhil
hi akhil,
i own FZ-S. can plz tel me wer exactly can i find k&n filter u told about???
hii friends ankush here….
m goin buy KARIZMA red color this week..
i have 2 drive it more then 25 km a day..
so plzz tell me at what speed should i drive it probably..
50-60?? is it ok??
Hi KARIZMA Red Owner,
Congrats!!!!
It’s Coooool Vehicle and powerful too
always drive the bike between 45 to 50 in same acceration not tp and down speed..
Try to maintain the speed between 40,45,50 at the max
unless it makes clutch noise u can drive in that speed…
U can drive upto 55 speed..
Don’t do Wheelee or sudden pickup like other’s so often
it leads lack of engine power after some time…
if you maintain the same it’s not just a bike it’s like a ship….
Such a Excellent bike..
Fantastic bike and amazing comfort with nice road grip..
Advance Congrats!!! for the New Bike..
Never drive rash or chase if other stupids tempts you..
if you lose your bike it’s your lover..and heart..
for bike lover’s bike is first rest next..
so never drive rash
Take Care..
Let me know once you brough new bike..
All the Very Best….
Have a Great and safe drive for ever…
hi frens this is Kaushik..
i own a pulsar 150 dtsi 2005 model.. I’ve run it for abt 30000 kms. my bike’s performance is reduced considerably.. pickup is down n mileage is just 30. sometimes below tat.. my bike desperately needs help.. i’m not much into these bikes n stuff n don’t know much abt them.. mind you i’ve not done any kind of modifications to my bike. so guys pls help me out… what could be done to increase the performance? guys i’m countin on u…
I am living in Indore & I want to buy a bike within a week.
I want to buy a Karizma & mileage is a concern for me. I asked many Karizma users from my city & the avg. mileage I recorded was 25. Is it possible to get mileage any where near 38-42. Pls enlighten me.
Hi
I have Bajaj Discover 125 CC spokes version bought in 2005. the bike used to give me good mileage for all these years except once there was a hole in Silencer which after rectification got resolved and the mileage came back to 52 Kmpl in city. but lately again it dropped down to 47 kmpl after I gave it for servicing. since then they have not been able to understand as to why the bike is not giving the desired mileage. they have checked the silencer and its packing and what not but all thse have not improved the mileage. Please advice.
Hi Frnds,
I have Discovery 110CC (CT 100 Engine). The mileage am getting is 45-50. I ride between 40-45 kmph. smooth rider. still the mileage is same. As its a CT 100 engine it should give more mileage than 135CC. Anyone who knows how to improve Mail to aaru2u@yahoo.co.in. or reply in the same. Thanks.
I have super splendor self start type byke. The bike is alloy wheel type. I want to know how much air filling in both tyres front and back.
Please let me know. beacause i have only get 45 km/l mileage
Manoj. M
Hi,
i have Hero Honda Passon pluse, my bike(4 years old) run over 20000 Kms, but the problem is that my bike gives avg. 53Km/L on highway (bike never given avg. 53+). Please help me out to improve the mileage, because its not a sufficient avg., bike should give more than 65 on highway. the condition of my bike is very good, pickup also high. i have use proper gear shifting accoring to speed.
Please help me, send ur suggestion on my e mail ID: harendrasinghvimal@gmail.com
Thank you
Make: Bajaj Pulsar 150 DTS-i
Model: March 2005
Mileage: City : 55-58 KMPL Highways :>60 KMPL
I love the performance of my bike. I have only replaced battery of bike since 2005. Its virually maintainance free. But you need to service it regularly.
i hav rx 100 1996 model japan.it gives me milege about 25 km/lgive me some tips to increase my bikes milege plz,,,
i hav rx 100 1996 model japan.it gives me milege about 25 km/lgive me some tips to increase my bikes milege plz,,, and i have a pln to modify my byke to a dirt byke so what would it cost me for it,,
i m having Yamaha RX-Z 132cc,1998 Model. My Baby gives me Exact 50 Kmpl Mileage.But i want to increase my bikes mileage plz give me tips
Hi,
I am having Pulsar 150cc upgrade model UG4.
My bike is giving a mileage of 42KMPL.
My gear shifting is usually like this:
1st – 0 – 10
2nd – 11 – 18
3rd – 19 – 25
4th – 26 – 35
5th – 36 – …
i mainly drive in a average speed of 45 KMPH.
Request you to please let me know whether my gear shifting is fine or not? Does this gives a high load on the engine? Do I need to change this range Gear shifting? what should i do to improve my Bike Performance as well as its life.?
Please do reply….
Awaiting for you reply….
Thanks in Advance.
my zma gives a mileage of 33 with an average speed of 60kmph
my discover135 gives 35kpml wat can i do to increase mileage?
pls advice me
hi, this is naveen sundar, chennai,
i am having herohonda splender
my gives 65 kms mileage,
i am studing mechanical designing
hey
i have a 1995 kinetic honda. i hold emotional value to this vehicle but my only reason of concern is that its a two stroke vehicle resulting in me buyin a litre of kinetic 2t oil from indianoil once a month.!is it the same with others? and i barely get a mileage of 20 with this in optimum driving conditions.im a student and hence my major chunk of my pocket money goes in this.any1 can advise me as to wat to do to reduce the oil consumption and increase the mileage??
thanx sharath
i wish to buy a cbz wht i should do to give more mileage for my bike
im using cbz xtreme from feb-2009. i got services from hh dealer.im getting 42kmpl in city driving conditions, is it correct mileage or not.plz give me reply..im a great lover of cbz the time when it is launched
Hi!! I’m using my dad’s HH Splendor ’98 model(The 1 wid an old stlye silencer! The sound ‘s awesome!!!!). I get 60-63km mileage in Bangalore city.
HI,I Have a Pulsar220fi and am really satisfied with its mileage around 44 kmpl and i ride like a speed 0f70,80.
sir i have starcity es alloy 2008 model i want to know my bike mile age so kindly help
Hi, Good to know about your tips.
I am using Pulsar 180cc UG4 model and its been three months as of now.
The new bike is little heavy compared to UG3 model and thought this might have a direct impact on mileage, surprisingly I was getting a very good mileage around 64 to 67 KM regularly until I gave it for first servicing . Now the mileage is dropped from 64 to 58 KM . I always ride my bike around 50 to 60 and some times 70 to 100. I can achieve this mileage only if I maintain the tyre pressure 28/35.
Hi All,
i purchased used discover 125, i tuned the fuel screw to 3.5 times from full tight and then adjusted the idler to slower rpm now iam getting 60k on highway as my riding speed on highways is around 70 to 90 my engine rockz and didnt seen any vibration s better all u try this settings start from 2.5 revolutions to 3.5 in between that u will get good result
how to increase my pulsar 220 DTS-I`s average??
which extra parts can i remove so as to reduce excessive weight of my pulsar 220 DTS-I? plz inform abt this to me as fast as possible…
i hv yamaha fz16 …15days…covered 490kms…its giving 27-30 kmpl…:(
plz advice…
its killing on my pocket…
my discover 135 gives 40kmpl pls advice me
hi myself sandeep i m thinking to purchase yamaha fz 16 but i m very comfuse about the milege
kindly tell me the correct milege of fz16 and some tips to increase it
Hey friends,
I recently purchased Apache RTR 160 ( about 20 days back) and my bike is giving an average of only 30 kmpl. Is there any adjustment needed in the new bike?
I always use XtraPremium petrol. Does it make any difference if I switch to normal one?
Also my bike’s ignition frequently turns off while driving. What should be the exact problem?
dont rise the engine for 1000km
as my dis 135 took this problem at first
I have a royal enfield electra 5 geared with electric start and disc brakes. I get a fuel efficiency between 32-34Km/L.
i m regular reader
i have my Yamaha FZ16 with 8000 km dirven
before reding this forum my bike never give me more than 25-28 kmpl after applying all of ur tips like before start bike warm up no extra weight tyre pressure a found it 32-36 kmpl
i want to give one more suggessin which i feel myself if we ride FZ16 with 80-85 kmph we should wear skin tight jacket or cloth and remember cloth should not be loose otherwise it will effect ur riding
FZ is a better option in comparision 150cc bike segment FZ16 give 30-35 kmpl in city 40-45 highway i have this bike since last year
don’t worry dude
before 3rd service this bike give 25-30 kmpl after that keep bike proper maintain like dont use extra weight like diggi if u r using diggi it should be aerodynamic keep air pressure 40-45 rear 30-35 front chain shuld not loose or tight and most important disk break should not make friction. u can check urself drive ur bike 3-4 km without applying front break after that touch disk break disk if this is hot, adjust it
can anyone suggest me for discover 135
my bike gives milseage of 46 kmpl
pls advice me.
thanx
plz tell me the milege of apache 150
if u guys are talking about mileage then talk PLATINA it gives 60-65km/ltr in city and 70-75 km/ltr in highway…..its a good bike,the heavy bikes cant give so much mileage
Hi,,all,,
Am using Yamaha FZ-16 its giving exactly 35 in city condition..and 38 to 40 in high ways,,it almost complet 11000kms in 10months..
hi guys..
i i’ve booked a pulsar 220 carburetor version……… i like to know the mileage of it..? so plz help me
Dinesh, I like to hear from you. Plz let me know ur bike mileage.
I am using P220 carb version. It gave me 44 to 47kmpl roughly.
Now its only 30 to 37kmpl. I know why its so low now a days.
I like to hear your bike mileage.
Hello…!
I am having Splendor – year 2003. In starting it gave me mileage of upto 68 Kpl, but now it is giving only 52-55 Kpl,
..I keep care of my bike, and give it for serving regularly…. can u pls advise how to improve present mileage….
If it is not going to improve… may go for new bike…. pls advise which one to buy… mileage and value for money are the requirement….. Usually ride in city for 10-15 Kms per day… and twice in a month go for 120(return) Kms travel.
Pls help.
PSR – KUTCH
hi.. guys…
Ive got a pulsar of 2005 ending model…..
condition was superb…… Engine smoothness was Good…. gear shifting was also smooth… only once my cdi unit was gone(current coil..)
remainig all was good…
Do u believe me my pulsar gives above 80 kms…mileage when it was riden at speed of 40-50 in High ways……..
In city it gives 65-70….
my mech also doesnt believed it… ive showed him in mileage test by taking 100ml petrol it gave 8.5 km….
in long journeys i will drive at 60-70 kms..sometimes 80kms speed then also my bike gives around 70 kms mileage…
Thank god for giving me such a good bike….
u can contact me by my mail… information given by me All was true….. God sake…..
Hey dude i have pulsar 150cc of 2005 model which runned almost 35000 km’s n its giving mileage of 45KMPL. Please please do suggest me how to get mileage of 60 n ABOVE. that is enough for me. Because i daily travel around 80 km’s to go to my office n college n i’m spending around 150 bucks just for petrol. At the end of the month i’m spending almost 4000 rs just for petrol. I can’t bare this anymore. So pls do suggest me soon as possible on my mail(srinathreddy0533@gmail.com). Pls dude
Ive forgoten to give a advice to pulsar riders…
To get a good mileage compulsorily use kick stater oftenly… in mornings ang the important thing is…..
The RPM….
dont give throtle excessively…….
By my riding experience from 2002… iam giving this advice…
give throtle upto 3… initally for lower gears u can raise below 3.. slightly more than 3(3 is best) for all gears…
and try to drive at 40-50 if want to know ur bikes utmost milage… this is not a joke (slow driving)… i know…
I want all u dudes also to get good milaege… also u can enjoy performance sometimes if u dont care for mileage….
these r very useful tips for a passionate biker….
Hm…….well if we talk about the bikes, there are one animal which is not talked about much but has got something in it. I am talking about all new Hero Honda HUNK 150cc. You all think your bikes are cool, come on the kind of power my bike generates under racing conditions I bet no other 150cc bike can do it. Mileage is about 40-45 kmpl I don’t expext much at high speed of more than 110kmph. Generating top speed of 126kmph with raw power of 14.2Bhp. And the design itself cuts the air because of its two wings on the tank. Sitting posture is designed in such a way, it gives a perfect balance of control at high speed. I think before you talk about other 150cc-180cc bikes, consider The Coolest Hunk as well.
My friends, now pulsar, unicorn, apache are gone…
THERE IS A NEW FISH IN THE SEA.
Cheers!!!
Hey lalit sharma u talk of hunk then what abt YAMAHA R15. i talk abt that bcoz i possess that. it gives me a mileage of 40. i drive it very rashly. i think thats much far better for me. its a perfect bike any 1 can drive. i have bookd for karizma zmr. i will be gettin it in 1 month. i will be mentionin abt that also soon.
Lets see, what you have got in your basket. But R15 is a different class. I have no contradictions in saying that R15 is a better bike, no doubts thats why I did not mention in my blog about R15, I wrote about other 150cc bikes like pulsar, Apache and Unicorn.
I have also booked a black Karizma, would get in 15-16 days. I am sure we would have a great time with Karizma. Good to hear a response against my blog. Hope to see more from your keyboard.
Cheers!!!
wow lalit thats great u r gettin a karizma. i too bookd for a karizma bt droppd nd pland for ZMR. i prefer R15 than ZMR r any other bike. i like it a lot. i have changd its back tyre. bt still i get a mileage of 40. i have put a magwheel. so i say that bike is the best than all, bcoz if u maintain it a littl bit it will be smooth nd runs good enough.
hey lalit u also said a new fish in sea, bt thats nt hunk. its goin to be RR15 thats goig to be released shortly with 180 cc nd 24 bhp which is more than karizma.
ther is also harley davidson, r5 nd many more to be comin mostly in INDIA in 2010-11. So always keep watchin for a big fish. do not get compromised with the small one if u have the chance.
i have bajaj pulsar ug4 150cc new one and its give the mileage of 27kmpl is this ok……… i dont think so
Hi………. sumit………
This is tooo odd man…
Ur not getting even 40kms….
Better to go for check of carburettor and get your bike serviced….
ug4 bikes are giving too much less mileage… thats true.. but not less as that u get…
I gave some tips above (on Nov2)… better u can follow them to get good mileage….(if u really want mileage..)
And all make sure ur bike get regularly checked and serviced….
post ur comment…..
hey udaya,
I mentioned 150cc bikes..
lets be in present.. till now we dont have any other brand better than Hunk in 150cc accept R15..
We would see big fishes as well. but let them come first..
cheers..
i m owning fz 16 man its a master piece
but when comes to mileage factor it sucks man
it gives in city 30
in highway 35
hey, it doesnt mean that i m degrading mi byk and manufacturer YAMAHA
it is first class in byk
i hav a nxg it is a good bike & gives me a satisfying ride .it gives mileage of 58 to 64 kms.
i hav a yamaha fz16, i’m gettin a mileage of 36 to 42 in the city.
and the 2nd service is due soon.
Hi,
I have cbz (old model),
I am satisfied with its performance and pick up, but the problem is that I am getting a very less mileage. Max and min mileage that I got is 30 and 23 respectively. I do not accelerate much but I use to ride @ 80-100speeds. I am not interested in riding my bike @ 40-60s . My spark plugs,engine oil are all correct as directed by the company.I am a regular reader of Autocar India and I use to follow the tips and suggestions .I use to maintain the tyre pressure @28 and 32 . I use to change my oils before 2000kms and I use to do all things to maintain my mileage. So will you please tell me the steps to increase my mileage?
As already stated above I need a decent mileage, I am not expecting a mileage above 50 but without 40-45 mileage I cant survive. I am a person who covers about 70kms a day. CONSTANT 80-100 is my speed . I dont use to change my gears frequently , brake or accelerate much. Will you tell me how much is the maximum record mileage of old cbz model? How to get a decent mileage ? Is it possible for me to get an approximate 40or45 @ 80speed? PLEASE help me to solve my problems.
If I use C&N air filters what are the advantages and disadvantages? will it effect my mileage? I need a good speed as well as mileage. I am ready to sacrifice my mileage till 45 for power.Wil cbz old model get 45-50 mileage ?
WILL C&N AIR FILTERS INCREASE
MILEAGE?
BHP?
PICKUP?
I think if the air intake is proper the mileage increases! is it true?
Whether iridium spark plugs and c&n filters increase the mileage?
Suppose if I am going through a small and narrow road should I go by frequently lowering my gears up and down or @ constant low gear ? Is it necessary to put the overdrive gear @ a low speed with slight knoks? Or is it desirable to continue in the same gear?Will it effect the mileage?
SO if I change my filters to C&N will it help me to increase the mileage?
What are the tricks to increase the mileage ?
Is speed inversely proportional to mileage ?
Should i change my filter to C&N to get more mileage?
Should i go at a constant speed between 40 and 60 to get a good mileage?
Does speeding decrease the mileage?
I bought new honda unicorn.
i did the 2nd service( in 800km) too..
the mileage is around 50kmpl.
I am first time bike rider
Let me know some tips..
@Jagan
whats your av: speed?
i have kawasaki ninja and fazer launched in india recently
kawasaki ninja gives an average of 25 and my fazer gives an average of 30 they both are in good condition. Average is quite low what can i do please suggest me……..!!!!!!
THANX in advance
Both ninja and fazer are power bikes.Performance has more importance than mileage. I think you will get about 40 for frazer if u ride and maintain it well.
Pulsar 150cc 2004 model – mileage is 50-55(kmph)
Hi Dear,
I hav to buy yamaha fazer on tis month..
Plz let me knw sum suggestion n tips..
also want increase d mileage n maintain it well..
Hi,
I hav to buy yamaha fazer on tis month..
Plz let me knw sum suggestion n tips..
Also want increase d mileage n maintain it well..
Let me knw speed limit, which is better company for engine oil.
Hi Guys!
Having read all these posts, I would like to state my opinion too.
) but in the city, i drive rash! 
I own a splendor 2000 model. Its giving me a mileage of about 55-60kmpl.
I am a college student and drive on the highway often as my college is situated on the highway only.
I drive on the highway at a speed of 60kmph (decent
But still my bike gives about 55kmpl, atleast!
Now, i want to changeover to a new bike. I am thinking of getting the new pulsar 180 UG IV. But my dad is adamant in getting me an Apache RTR 180 as he says that TVS service, and spare parts are cheaper than bajaj’s. Is that true?
That is because I want the bike for another 2 years after which I will be going out of India for further studies, and behind me, my 15year old brother and my dad would fight for the ownership of my bike.
Please do suggest me if I should go for pulsar 180 or RTR180?
Also I’ve heard FZ-S giving a mileage of not more than 40kmpl. So i’m keeping that out of the league.
Could anyone please help the distressed?? I am planning to get the bike on the 1st of January, 2010.
PLEASE REPLY ASAP!!!!!
Thanks.
Hi! guys…
I read this review page from top to bottom and found few buddies have posted the very useful and precious tips. Guys actually I’m facing a serious problem with my pulsar 150, 2002, Nov made. Actually Since last 1 month around, a peculiar problem I’m facing and that is, When i run at the constant speed suppose 60 kph then all of a sudden bike start giving a back on to the engine and firing strokes changes like bullet, and i get a feel like I’m dragging something tied heavy with my bike but this problem was not constant and it was for around 1/2 km and after that it’s turns to normal. When i visited the mechanic he did all the setting and cleanups of carburetor and finally he told that i have to replace the carburetor rest everything is fine, but Since he hasa re-tuned my carburetor the bike became in the worst condition and now everytime it’s running like that i’m dragging something with this and bike firing is sucks engine heatup like anything within 10 kms only and engine is chocking fully. I visited 2-3 mechanics but the’y are not able to diagnosed the problem and saying the carburetor problem finally i replace the original carburetor from bajaj showroom but still the bike behavious is same. Sometime it get good settings that time pickup is good but again all of a sudden it give back thrust and as i open the throttle it gives more back and finally i see for full throttle it goes up to 65, in normal condition i tested this bike top speed 105kph and ultimate pickup with 40kpl city milegae.
Please suggest some solution. I want to know that what could this problem be?
Thanks.
I don’t think there was any problem with the carb. which was changed unnecessarily.
Very likely problem in my view is related to the electricals / spark plug. You may please get them checked up by a good mechanic.
Mr Bhavya according to my opinion HONDA UNICORN is better for you.It is because it gives a decent mileage,look and power….It is the smoothest bike. Parts are costly but the chances for damage is too low. HONDA IS THE BEST BRAND.
Pulsar and apache are good bikes BUT they have a lot of technical problems.
The engine of apache and pulsar is not as refined as the HONDA AND YAMAHA.
Pulsar and apache looses its grip within one or two years.
I
FZ is a good bike, a hit model which is liked by the youth. If you are a good driver then you can achieve a mileage of 45-50 or much above that.(above50).IYou will get a good mileage more than 50 when you become a good driver. The vechicle should me maintained well with prompt servicing and tunning!Apache(you will get the VALUE FOR your MONEY )Apache offers a lot of features @ low cost but as time passes it looses grip.
I STRONGLY RECOMMEND U UNICORN.
FROM
SOORAJ.M.S
(JAROOS)
HI BRO!
IM 4M KARNATAKA N OWN A KARIZMA R!!!
actually i have a major prblm wit mileage!!!
the showroom ppl r not gettin throug it even after my frequent complaints !!!!!!
i have done all d best 4 a better performance!! it gives a mileage of around 37!!! can u plz sort out tis problem 4 me????
hi ….
37 is a good mileage for karizma but people have claimed much more mileage….. so pls tell me more about your bike , constant speed,bike year and way of riding!
i hv recently bought a pulsar220 dtsi……
n got the tank full. the milage by my bike ws sm where around 20-25 will my milage be inscreased with time wat shud i do to get more milage…….. as ma other friends with same bike r getting an avg of 40-45…….
To Saim
You will get more mileage afer few services.
Hi,
I own a Honda Unicorn Dec 2004 model. I get it serviced at an interval 6-8 months regularly. Small glitches, i get it fixed immediately.
I get a mileage of 41Km\Lt.
i got a honda dio… 7 yrs old… city mileage of 44 km and highways @ 58 kmpl… great
guys,
it gives me 65KMPL in city didnt check in hi’way. im gonna buy FZ16 (a giant leap)
i have my dads Splendor 1995 model
Ravi
hey i own a cbz xtreme can u pls tell how to increase its pick up and mileage … which filter to buy
TO INCREASE THE PICK OUT YOU HAVE TO TUNE THE BIKE…. K&N FILTERS ARE THE BEST FILTERS FOR POWER AND MILEAGE
Dear all,
i am using discover 135 new version without disc brake
i am facing very serious problem in mileage i am getting only 40-45 kmpl on road condtion but in undermachine condtion mileage test i am getting 72 kmpl i have checked very thing they is no ploblem Total distance km covered 11000 km and my speed 50-55km regular air check ,use speed petrol only .
Apart from carbetetor tuning, air presure ,driving speed Is there any reason for mileage drop,
Pls suggest me,
Regards,
Rajan Satish
Hi…
i m having a Splendour NXG (100cc)
and not having a good mileage,its just 50km/l
other 150cc bikes r having more mileage compared to my 100cc bike.
plz help me>…
guys,
i have bought a pulzar 180cc, it gives me a average of 32kmpl milege in city,
what shall i do to increase my bikes help………..???
hi guys i hav karizma r n is amazin byk bt nly 1 problrm of average hw should i solve it plz help…..
Hi guys, I own a discover, its 5 years old..done 34k kms. Iam getting a mileage around 50+ only in city, daily i ride 7 kms to office and back..now a friend is accompanying me..hes a bit heavy too
have to check the mileage now.
i just bought a new pulsar 180 on 12/12/09
it gives me a mileage of only 20-26kmpl
what shall i do??
Thanx sir for the complement, but what about my ninja can i raise more mileage of kawasaki ninja to around 35? at what speed i shall ride ninja and fazer to get maximum mileage?
now fazer gives only 25kmpl and ninja gives just 20kmpl
Hi all!
I own a Bajaj pulsar-150cc, 2007 model.
I am getting around 35-37 kmpl mileage.It is in good condition.Is this mileage is normal or It should perform better?
I am using TVS Apache 150 CC from last 3 years. I am getting average of 60-61 KM ya but after driving under good condition such as speed of 40-50 KM, regular servicing of bike, using good additives for engine.
heyyyy i got a new karzma on thiz new year bt im really not happy wid itz mileage …itz near 22-25….giv me some suggestion…
Hi,
My bike is giving me 45-50 Km/liter, i know this is on lower side, so kindly guide me.
Model is Tvs Star city-ES 100 cc.Run is 22,500 Km in 2 years,
regular maintainance is done.but still it’s not giving me more milage.
Please
Give me a tips Or setting or changes to increase milage of my TVS Star City-ES 100 CC bike.
Waiting for your reply,
Regards,
Viju.
hi! iam new to this but i heard ur tips & suggestions are good.
i would like to take a new bike but i am having some confusion, can u help me. my frnds are suggesting me to take rtr-160, pulsar 180. but i heard that for apache vibrations are more.
My requirement is a good loking bike , which gives a mileage of 40 or above , and reuire less maintenance…….
hi srinivas! honda gives more mileage, power and less maintenance. y cant u try honda? . rtr160 is a good bike…. you will get true value for your money….! the engine of pulsar and apache is not as refined as the honda and yamaha company. I am not telling its bad . rtr160 is much better than pulsar180.
<>
MILEAGE TIPS -Tyres, air pressure, spark plug, carbrtr, speed etc makes a signfcnt change in the mileage of the vechicle!
drive between 40 and 60 . use good fuel and oils . clean ur carbrtrs,filters frequently. USE ONLY ORIGNL PARTS. the air pressure of the tyres shud me maintained well. perfect gear shifts , smooth drivng .–these steps will definitly increase ur mileage..!-jaroos!
MY EXPERIENCE…
MY name is SOORAJ.M.S. ( called as JAROOS). I am from Thrissur Kerala. I am very crazy about bikes . I have used almost every brand of bikes now in market . So i would like to share few things with you people.
Always buy trusted brands.(honda, yamaha etc)
Power is inversely proportional to mileage and so power bikes delivers less mileage.
Never buy an old bike even if you get it cheap .(pls check the engine efficiency before buying)
Always maintain you vechicle properly with proper servicing.
i hv a honda dio, its milleage is very poor.. i like to race. now my dio reaches 100 speed with full acceleration.. before it was just 90-93.. but wen i ride it even at 50 speed its result is very poor. it just gives me around 28kmpl in city & on highways it reaches around 32kmpl.. Hey guys plz do help me wit dis… plz reply me regardin dis on my emil id,
my email id is,
mavens28@yahoo.com
sir which is best bike in fazer and 220 in mileage, looks
Hi, I have pulsar 150 with Rear MRF ZAPPER Q TYRE, can you tell me the what is the mileage should of my bike? i will waiting for reply
Hi…. Vinay…
Which byke r u Having…??
Is it Dts-i…??? model…???
2002-2004…???
2005-06…???
2007..to till now…??? Dont expect more mileage from the Models starting form 2007…it will be utmost 45-49…
Hi…. srinivas(Feb3)…
comparing Pulsar180 and apache RTR160…
Pulsar is the best pick…..
TVS never gives the value for money….
Closely observe right starting from kick starter rubber to everything… all are of cheap quality compared to Pulsar(Dont compare with Honda or Herohonda…)
Ask anyone even if you drive rashly pulsar is more controllable than Apache…(My personal experience and also most of my friends having Apache Too..)
Also Apache gets more repairs than Pulsar(Mechanics opinion)..
Apche 160 & Pulasr180 has got similar milage…
Power of Pulsar 180 is incredible 17ps…(More than Apache160 but RTR 180 has got same power)…
Dont think that i’m praising Pulsar… it has too its limitations.. Like detatchable stickers.. poor clutch plates(Apache too..)…etc….
So the final Decision is up to u..
Hi Jaroos…..
Honda got refined engine than Bajaj’s and TVS… u r right…
But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. Dont think that i’m underestimating Honda bikes they are good enough.. i agree… But..
____Too much servicing cost…
____spare parts cost are Horrible…
____servicing should not be done by normal mechanics….
Hi… Srinivas(Feb3)…
I forget to tell about the Vibrations of Apache its True and fact in rising speed around 70 or so… IT IS AGREED ITSELF BY THE TVS company……
its true Dude… go for a trial if u dont believe…
My friends also reported the same problem….
DO U KNOW THE PROBLEM CONTINUED WITH RTR180 ALSO…
Its A Sad drawback for RTR loverz…
Hi,
I have Pulsar 150 (Not Dtsi)2004 March Model. I have used MRF ZAPPER Q REAR TYRE, i have used Castrol Engine oil after 2500 km. can you tell me what is the right milegar of this model, and if i used normal pertol (not extra primium) so any proble with that?
Hi..!
I have HONDA CBF Stunner. It’s nice bike it gives me 45-50 kmpl.
Can u plz tell me how to check @ whether engine oil needs to be changed..
Thanks
Vishal
Hi….Vishal….
Dts-i models give more mileage than previous versions…
u can expect a decent mileage of above 40-45 if u ride decently with good carburettor settings…
Adjust carburettor idle settings to 1 (rpm*1000)…
ride between 40-45 not exceeding 3 rpm*1000(or slightly above 3) for every gear.. lower gears can be operated below 3….. it will give you mind blowing mileage.. try this…..
u r using the engine oil for longer distances it is not right(2500)…. try to change the engine oil every 1700-1800 kms or below… it will be good… if u love ur bike and want to keep it young u can change the oil below 1700kms by checking it… it helps engine remain young.. keep it in mind.. dont think for 200rs… use castrol active4T…
Use only Normal unleaded Petrol from a good bunk…
Prefarably 1st.. Bharat petr.. 2nd.. Hindustan petr.. Gives u best results .. i can bet for this with any one….. But dont use SPEED.. it will alters the performance and effects the life of engine and silencer… the same with Extra premium… i can bet for that also…
Also try to avoid petrol in IBP and others…
Post ur comment….
Hi… Vishal…..
see this post i have given Kms for changing oil.. but go for the preferred oil for stunner..
For checking the oil remove the oil cap use cutting pliers….. take a clean cloth and wipe the level strip.. and insert into engine that means dip one time and take out and observe it… and touch with ur clean finger…
it it is some what black or black.. then immediately it should be changed…
also if it is down the level of strip it should be changed…
by touching oil if u r having a gritty feeling or having heavier feeling.. then it is time to change it….
Hey vishal…
Ive forget that for checking engine oil the bike should be in centre stand…. and bike shoulnot be in overrunned condition…(i.e checking after a long drive)…gives wrong results….. check the oil during hault condition
hiii frndz….!
Its true that apache vibrates after 70 . When we compare with pulsar dfntltly te pulsr dominatz. The quality of the parts are low but if offers more features… tatz y appache got te captn ‘value for money’. It looses its grip fastly….!!!!!
1. Digital Speedometer.
2. Petal shaped disc brakes.
3. Serrated design stickers.
4. Naked chain cover.
5. LED tail lamps.
6. Clip on handlebar for various positions.
7. Service and battery indicator.
8. The digital display has a feature to test the top speed achieved.
9. You can also test your 0-60km/h timing on the digital display.
10. Tank cowl like in the Bajaj Pulsar 220.
THESE FEATURES ARE THE ATTRACTIONS OF APPACHE. the Apache RTR 160 has been upgraded with electronic fuel injection(EFI) and becomes Apache RTR 160 Fi. Is ter any othr bike which givz tez many facilities???? I KNOW THAT THE QUALITY IS LESS . But still it offers many features and tatz te reason for te captn ‘value for money’ hop its clear! wen v compare te same catgry of bikes v can c tat appche offers more facilities even though the qualty is less…..Its just my opinion….! pulsr offers more pwr and stblty than rtr.
THE SEVICING COST OF HONDA IS HIGH BCAUSE IT OFFERZ QUALITY PARTZ. THE CHANCES FOR DAMAGE IS VERY LESS,ENGINE IS VERY MUCH REFINED,COMPLAITS ARE VERY LESS, HONDA OFFERS GOOD AND PROMPT SERVICING.
_THE PRICES OF SPARE PARTS ARE HIGH… BUT THE CHANCES FOR DAMAGE IS VERY LESS…. A HIGH PRICED QUALITY PRDUCT IS MUCH BETTER TAN LOW PRICD ORDNRY PRDCT….
SEVICING DONE BY TE XPERTZ OF HONDA IS BETTR THAN TE SERVICE PROVIDED BY TE LOCAL MECHANIC….!
I CANT UNDERSTAND WHTZ TE PROBLM WITH TE HONDA BRAND…!!!!!
HONDA OFFERS THE SMOOTEST ENGINE…..!
IT OFFERS GOOD FEEL TOO….
-JAROOS
XCUSE ME …..
I read ur comment and i hav a small doubt regarding ur post….
”But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ”
please make it clear. what r u trying to say?
r u tellng about the pick up ?
please describe ur problems that u hav noticed….
hi i’m Nirmal.. i own bajaj XCD 125cc and my mileage is 40-50!!
Hi… Jaroos dude….
U only agreed that Pulsar offers more stability than Apache… Thats enough..
Coming to its Fi… Its only a technological upgrade dude.. not useful to u or me or any indian.. it requires highly efficient Professionals (not normal showroom mechanics)to monitor.. and its highly sensitive and cost effective and cant be monitored within 1hour or so like that of a normal carburettor..
Also main thing is COST… Do u know what made the Bajaj to quit the Fuel injection tech of P220 and come back to normal traditional carburettor its the above terms.. and also normal carburettor can be handled by even U and me man.. i think u got the point.. I’m not hating FI dude.. im only stating the fact…
Also u have stated the facilities offered by RTR these r good but these gives no significance to people… they go after seeing the total outcome… Hey dont conclude im hater of RTR… it is a good one…
coming to HONDA concept….
Hey Dude i agreed na that HONDA bikes are good…
But coming to cost effectiveness and servicing charges and spare parts these occupy a least share in market.. thats it…
I can give u classic example…
Take Unicorn & Pulsar(or)Apache.. if both the bikes fell and parts are damaged.. By paying the bucks towards Unicorn our pocket will be torn out when compared with Pulsar(or)Apache…. its just an example…
The average indian or student or job worker thinks above fact and opts for the other 150cc bikes…
According to my opinion and lots of my friends opinion and as an Average INDIAN the people when buying anew 150cc bike they think of
Pulsar—-
optimized for rash and fast driving with certain limits.. good for looks.. power… pick up.. spare parts cost is low.. technologicaly an upgradedone (but previous versions 2005-06 are best versions of pulsar..not my opinion.. its the servicemen opinion)…….Major Drawback.. NO RE-SALE VALUE…
CBZ-xtreme—-
An outstanding bike in the whole 150cc segment…
No need to Describe a Herohonda bike.. Right from starting Cd100(My favourite in those days) till ZMR these bikes rock the market.. IN KEEPING VIEW OF COST(These have more costlier than Bajaj)..But worlds numberone…1…!
If u want an xtreme in Hyd u want to book two months before.. thats the craze ….AND ALSO MINUS OF IT…. MY FRIEnd waited & waited & waited for it and went for Pulsar200
But HH Definitely Good than Bajaj And TVS…
Apache—
U described about it dude… No need of me..
Unicorn—–
Purely a masterpiece..
These ones are for those who die for quality..
No need to think for taking it..
If U HAVE A LOT OF MONEY..
i will justify my Prevoius comment below….
Yamaha–
Takes time for analysing because these are new to market.. for more power these bikes r ultimate.. R15 is enough.. no words to decribe it…Its just afterall 150cc bike but has ability to race with P220…
Also yamaha offers good quality…
Suzuki…
legend once before… samurai.. shogun…etc..
Gs150r has no looks sorry to say…. also same with other suzuki bikes.. less service centres…. the company has to wakeup…
MY COMMENT…
”But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ””But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ”
dude.. its the feeling man that the bike will give to u…
i will make u understand…
For example…
Take Dio or Activa.. go for a ride.. Plz think that they have gears and u r riding them(Im telling this i have no other example for a 100cc in honda).. ok….
Now go for a ride on HH Passion plus(i can tell an example in bajaj but those are not refined as HH or honda)…ok…
Both bikes are slightly similar in power and other terms…
Now what is your feeling..???
Honda is refined …k… i agree…
what made u feel apart from that.. the feeling the bike gave to u… UNICORN lags that when compared to Pulsar or X-treme or APache.. i think u have understood that..
Purely saying Unicorn a NUMB bike…. The More Refinement or other thing it gave the numbness.. it is good for those who want it.. CARS mainly Have the NUMBNESS………
But not for COLLEGE GUYS.. and common man… and bike enthusiasts..
Hey.. Dont think that im degrading Unicorn.. i’ve already said that it is a Master piece.. Also I LOVE UNICORN(NOT THE OLDER VERSION)…
cheers dude… Post ur comment…..
hi i am having a karizma r 2007 model , but it gives a very low mileage of 30 to 35 and also the top speed is 110kmph. i would be happy if u give some advice to improve my bikes performance and mileage. thank you
I have two bikes…
A Hero honda Splender..It gives about 55-65 in ordinary petrol and 70-75 in special petrol(eg:Speed).
Regular speed 60km/hr
And a TVS Heavy duty give about 85- 90
top speed 50-55
regular speed 40km/hr
i have karizma …the first edition when d bike was launched..the model is 2003…from the start day it gives me an average of 35..at all speed…as i participate in races n al usin d bik …there has been no change in the average til now from the day i purchased d bike…also i hav done some modifications to d bike which boosts my bike giving a top speed of 200kmph…which is a very top speed….i would like to suggest a tip…. when d bike is new…don drive more than 40kmph..upto the 1st service…doin so not only increases d performance but also gives longer life to it…n 1 more secret..u can adjust d pickup of d bike..when nt in use u can reduce d pickup..which saves lot f fuel..
hello sir…..i am a tremendous fan of pulsar and i own a p200..well my question for you is now my bike is 2 yrs old and it gives me a top speed of 121 kmph(single rider)
..i want to ask you should i go for K&N R1100(with jetting)and change of sprockets(smaller one may be 36-37 teeths).well right now i am looking for speed both pick up and top speed ….plz help
Which bike is better Fazer (new model) or Pulsar 220? (In performance, looks, speed, maintainance, mileage)
i have a new pulser 150dtsi..i brought it 6 month before..how can i figure out millage pre lit… plz suggest…
i use speed(petrol)…is it harmful???which petrol is good for my bike???
go 2 sum mechanic…dey hav an smal container f bout 1 litre…fil petrol in tat…check ur odometre…n c how much far it goes in 1 litre f fuel…for eg: it travels 15kms…den ur average wil b 15…
usin speed petrol n al is f no use…if u hav an feelin tat it adds sum pik up or so…do 1 thin…only once u fil speed petrol frm nxt tym u can fil any petrol …as d speed petrol wil mix up d othr tym u fil….d best fuel i recommend u is unleaded fuel….
p220…is far much better than fazer..
Hi brother.. i have CBZ X TREME.. 11/2007(BLACK) model and mileage is 40-45 in city.. and while im riding i feel engine is not smooth.. its a bit harsh, which irritates me always..
1. How can i get more mileage ..
2. How the engine will be smooth.
Hi,
My name is naved. I have a Honda unicorn 150cc model 2006, it gives me average mileage between 33 to 35 kmpl, how can i get more mileage from it now?.
Change air filter(Original Honda only), increase the Tyre pressure, remove sari guard, while next servicing ask to do performance tuning.
Honda Activa :- 47 during normal driving conditions…
around 42 during 60-70 kmph …done (31000kms,late 2006 purchase)
Can anyone tell me what is the mileage like for Suzuki GS150R for the period before the 1st Service while driving in a hilly terrain???
hey guys,i need to know if put up a sound makin air filter in ma bike…is it gonna reduce the mileage?…….
I have a RTR Fi for about a yr now n shd say tat i haven’t seen a better bike…It gives me around 45-50km/ltr…and wat is this nonsense about it vibrating at 70kmph???I have done a steady 131kmph on it n the bike is ROCK STEADY…
Honda unicorn 2009 model with a mileage of 55km/ltr overall
hi my honda unicorn 2009 model gives me an overall mileage of 55 kms / ltr . is it a good one?
which type of petrol shall i use in fazer and kawaski ninja
Hi to all the persons who left there comments.
Basically You have to follow some tip for making your bike fuel efficient
1. Check the tyre pressure regularly.
2. Service and oil change as suggested by the company’s parameter
3. Some bikes come with manufacturing defects that will not be known untill the first service of bike so list down all the problems and get it solved at the time of fist service
4. Don’t ride at a constant speed always make some 5-10 KMPH variation while accelerating.
5. Try to ride the bike in 40-60 KMPH range.
6. Don’t Change gear frequently if not needed.
7. Don’t use brake unneccesarly.
8. If the engine is used in cold condition then give 30 seconds to 1 minute to hot up the engine.
9. When you change your bike’s chain. Change the enitre set which include front and rear sprocket.
10. Make sure your carburetor is tuned otherwise you will not get proper mileage.
Thanks,
Mahavir
Hi friends
I’ve Yamaha Gladiator Type RS
2009 model
I’m currently getting a pretty decent mileage of around 60-63kmpl in City (Ofcousre the road that i ride in will always be clear)..:-)
I ride between 45-50kmph..
I never rev it hard..
I do maintain it as clean as possible..
It has done around 2.5k kms till now..
2 free services have got over
hi i m rohit.I have hero honda glamour.its average is approx 45.i want to know how to use gear mechanism and clutch for max average in both city n highway.
HI, AM A NEW SUBSCRIBER, N AM REALLY GLAD TO FIND SUCH A SITE WHICH HAS GOT INFO ON INDIAN BIKES, THIS IS REALLY A VERY GUD EFFORT BY U GUYS.. KEEP IT UP…
Am having 180cc pulsar, am gettn a average mileage of 45-47 Km
I ride a little rash,(upto 70kms/hr). I get it serviced with the authorised dealers as per the shcedule.
My prob is dat der is a noise coming from my engine when i maintain a speed of 60km but when i throttle it to 70 there is no noise!! is this the problem with Timing belt adjustment??
Nowadays i feel like am losing balance in my bike, i think dat my bike is not moving straight, it’s pulling me to other side, is it due to bend in the alloy wheel(6 spokes)? Shud i change my Rim of both the tires to overcome this problem.
hello,
I have got a brand new Yamaha Fazer 153 cc,
what driving speed before first service you suggest would be best for better mileage.
thanks
bhanuteja
Namaste,
I am facing a lot of milage problem with my pulsar 150cc (2008 model)which use to give 50-55 km /ltr before, but now withing city it is giving 25-30 km / ltr!!
last time when i complained to bajaj service centre, they checked the milage with 100ml of petrol which showed 5km !! that is 50km milage but when i checked my self again it is providing 25-30 km / ltr!! how to fix this problem? is there any way that i can get good milage again? kindly guide me. thanks
Hi,
I own Yamaha Gladiator type SS, its almost one year now. Initially I got a good mileage of 60 to 65 KMS/liter, after a hills ride the mileage has gone down to 50 KMS/ liter.
I have not done any changes to the bike, and I drive at the same speed, on average 40 – 50 KMPH.
Can you please help me.
Thanks in advance.
Hi. You have told to remove the saree gaurd. But incase of its needed what would be the problem? Pls post the answer for it
hi..
i have a star city 2007 model.it is giving an average of about40-45 km in city.i have got a engine cover as well as a modified silencer in my bike.so i want some tips to improve the average of my bike.
sir you are kindly requested to give me some valuable tips so that i can improve my bike average.
thanks a lot.
hi i have a kinetic honda 1998 model.
how can i improve it’s mileage bcoz i am not ready to have a new vehicle.
Hi everyone, i’m Gunawan from Indonesia. I own and use Bajaj Pulsar 200 DTSi, and from my experience, the fuel consumption goes like this:
1. City/Urban riding: Worst 38 KPL, Best 45 KPL (Jakarta has one of the shittiest traffic condition among capital cities of the world)
2. Highway/Rural riding: Worst 46 KPL, Best 56 KPL (best case achieved in a long, straight, flat highway on the north coastal road of Java island)
My bike has run around 12 thousand KM, and in a pretty good condition. It only runs on standard, 88 RON gasoline, yet the fuel efficiency seems good, even compared when i tried using the premium, 92 RON gasoline, doesn’t show much if any improvement at all.
Regards.
Hi ,
I have yamaha fz.My office is just nearby therefore Every day I travel only 5 km.
My bike’s average is 30-35km/hr.I want to increase my bike’s average.
Total km :1200Km
Please advise.
hi,
i am having hero honda passion plus bike and it is giving 40 per liter mileage only in city how can i increase the mileage pls send me the solution pls
send me the solution to my id naveen_nani1986@yahoo.com
thanx in advance
i have yamaha fazer 153cc how can i increase my bike performance
and mileage
I am having FZ 16 .it is giving 35 km per liter.how can i increase the mileage
hi…i have the LATEST BIKE HONDA BB twister its cool and have some milage around 57 or 58 in off road……..the company says 70 and some people gets 71 why such a differance occure
I own Hero Honda Hunk 2007 Model, You all will be surprised to know that it gives me average of 61 on highway and 55 in the city..very pleased with its performance..
my bike is glomour it gives only 40kms/lit wat i can do.
I HAVE A H.H.CBZ,2000,BLUE. I’M GETTING AN AVERAGE MILAGE OF 50KMPL. ON HIGH WAYS I GET AROUND 54KMPL . I HAVE GOT KARIZMA ALLOY WHEELS FIXED IN IT. I MAINTAIN A AVERAGE SPEED OS 40-50KMPH IN CITY AND ON HIGHWAYS AN AVG OF 70-80KMPH. ENGINE OIL I USE IS CASTROL ACTIVE 4T. I CHANGE ENGINE OIL FOR EVERY 2.0K TO 2.3K. GIVE ME MORE GOOD SUGGESTIONS TO MAINTAIN A GOOD HEALTH OF MY BIKE.
hi mamam plz let me knows abi shine bike to change it to sport look
Anil,
Hey buddy you mentioned above that “leave your engine start for 10-15 seconds.” So I want to know, that I have to give any acceleration during this 10-15 seconds or leave the Bike as it is..
hey deepak,
thanx for this all valuable info.
let’s would you please tell me that i have passion PRO
i have ride it 50 to 55 KMPH when it was new so is it any problem if any how can it be solve currently it is giving 55 to 60 KM/ltr avrage what can i do so that the avareg can increase
I have a suzuki max 100R it gives me 35 in the city and 40 on the highway.how can i take more mileage now?
I have a Suziki fiero which gives me 80 milege in highway and 70 in city…I am very satisfied with this…
hi frnz….tis s shri from coimbatore….happy 2 say i own a new plsar 220…well i luvd it i got it on may 10 ..but am not happy wit my mileage…i get 30 now…wil i get atleast above 37-40????pls can u suggest me for it??? i do drive within 40-60 inside city nd somtimes 80-110 due to some emergency….nd pls help me to do better….am mad ff ma bike…nd i don wan to leve tat hope…help me..solute me to my id…..pls
hi frndz…
i m plannig 2 buy a karizma.ma drivin s nt bad.
wt milage can i expect 4 it??i have drive arnd 30 kms daily
any other bike u suggest??
I have a Honda Activa, which I bought 1 & 1/2 years ago. Initially, I was getting a mileage of 35, since I didnt know how to drive properly. Then it had increased, and reached upto 55 km per liter after fourth servicing (I use Shell Petrol).
But of late, the mileage has been dropping to about 47-48 km per liter, though I take particular care about mileage as far as possible. Other external factors are there that cannot be avoided as listed below:
1. Traffic Jams, these cannot be avoided, but I try to avoid areas like M. G. Road, Majestic & Kalasipalya in Bangalore (synonymous to areas like Chandni Chowk, Connaught Place, Karol Bagh, South Extension, AIIMS & Patel Nagar in Delhi) as far as possible (travel to these places only rarely using scooter). But generally, they can occur anywhere within the city.
2. Cant avoid bad roads as well, especially if it is a routine route. If it is some route that I try to explore, and come across a bad road, then I dont take that road at all for the next six months, and this continues till that roads gets rectified.
3. Although I try avoiding sudden braking, but some clumsy autowallahs and tempos come from nowhere suddenly, and have to use them also occasionally.
I feel that the back wheel is not rotating smooth, and there is a drag when I pick up speed.
Could anybody suggest what could be the problem with the resistance of the back wheel, and is it customary to have resistance or not? If there is a problem, is it the bearing problem, or the belt problem, or the piston problem?
hi Vijay…yes even i feel the same thing with my activa. i feel that the back wheel is not rotating smooth.. something is blocking the wheel from running normally. but when i showed the bike to the active service center they said it wud ge fine after oiling and still now its the same. guess the more old ur vehcile gets and more wear and tear it happens with all bikes.
hi…….
Am rajesh.
I have fz16 me want to improve my milage my bike milage is just 30 how can i improve it
dear sir ,
my new 3 month old honda shine 45km/lit average give on high-way my average speed only 45 km/hr .please give me some suggestion for better millage
regards
dhiraj vigora
m-09228227983
Hi, i have apachertr160fi and it’s milage is about 40 which is not satisfactory so i like to increase my bike’s milage pls help me
my bike is hunk and my mileage is 35-40kmpl……mostly it gives 35…..i drive at a speed of 60.and i want to increase my mileage to 50-55 what should i do
hi i am new to this place. well i have a problem with my bike. i own a hero honda hunk 2009 model. well 8 months the bike works great but when its monsoon season and when it rains my bike starts but after a few seconds it shuts down. again it starts and shut down. can u plzz give me a salution to the problem as i keep my bike in good condition. i change the oil in every 1.5 months and give it for servicing every month. plzzz help me.
Well Shoaid – The same problem was with my hunk as well but i got it resolved. What u all need to do is to shorten the length of a pipe that is out there to throw out the water or dust from petrol tank. The location of the pipe is between the rear of silencer & rear tyre…it will be just hanging out there near rear mud guard…can be identified easily..lemme know if you get it done. Otherwise, u can take it to the mechanic & tell him the problem..
hi , i have a karizma2007. i am sick of my bike mileage, it gives only 26km/l. please tell me for improving the mileage. or tell me either we change the karizma engine. means can we fit the splender engine to karizma for improving mileage, i am not worry about speed and pickup after doing this.
Hi,everyone..,i have an Yamaha Enticer(2003) model.,it gives a mileage of 38/lit.,I read the description of that vehicle in a website.,its written, it gives a mileage of best case:62/lit & a worst case:55/lit.,My question is that how can i increase the mileage of my vehicle…,Any1 plz help me…
Hi,
I am using Apache RTR 160cc. Please provide your valuable suggestions for getting good mileage.Presently my bike is not giving more than 40Kms/Lit
@ Vishal well can u be more pricise with the pipe and wht may be the problem. plzzz reply man. i really need ur help. those jackasses in the HH service center took my bike for 3 days and could not find a solution. so plzzzzzz man helpp me really. waiting for ur reply. or just give me ur cell no i will give u a call if thts ok with u.
@ Venu well man apache rtr 160cc is ment for speed man. so tht means less mileage. but if u do not go above 50 kmph and dont wont much pic up then try to reduce the picup and put a small fuel pump. hope it helps u lol
im having apache rtr160 and it is giving a mileage of 38-40 so im not satisfaction with this so pl can u help me how can i increase my mileage
i have bajaj discover i like to travel
my has crosee 2 lakh kilometer . i had my bike 4 year back . it had been travel 6ookm at a day . till today i never had a problem to m bike . now i have modifed my bike which has been done by me . i want to post the pic of my bike i want ur comments on it ? how can i ? and is this desigen can go futher ?
Hey friends i got an apache160 two weeks back i filled 10litres of petrol and rode oly 280km in two weeks and it dried….. That gives me a mileage of 28kmpl…. So sad company claims that it gives 50and i don drive it fast too….. Max i’ve reached is 58and the service personal rode it and ripped my baby to 86 …. I dono what’s wrong wit it and performance is good but it’s mileage worries me…. Can u give any tips…. I’m waitin for ur replies
Dear all,,
I am Himanshu Bhardwaj from delhi, I am having a Karizma bike from last two years. From the day i am taking care of the things which a bike needed.. Like first thousand kilometeres i run my bike at a 40 to 50 Km.ph Speed. I used to change every part of my bike when it get weared the parts are genuine. Earlier it was giving an average of 40 in the city. But now after running 35000 KM. My bike is giving a milage of 32+ but why it is so after all i am doing all necessary thing to my bike. Please suggest me what else i a can do.
hi sir i ha an rx 100 bike the modle is 1988 it gives me jst 25 mileage d bike is fully stock and my friends rx 100 gives him 36 mileage his bike is fully poted so can u tell me tips to increase my bike mileage plz……
hi friend.i have 2002 apr. model rxz bike and it cross 100000km still its gives me 45+ milege.and it goes up to 132kmph.so from my view its enough for my motor.what u say friend
my bike is splendor+ of 2008 mdel,i have driven 12000 kms,but am not happy of my mileage,its giving around58-62.Am driving below 50speed,please suggest me
hello,
i am kiran, i have hero honda super splender, when it was new it gave around 50-55 mileage, max 50, for 4 years it gave 50, but after we gave it in hero honda showroom for service, it started giving 40,and slowly decreasing to 36,earlier we gave it in other service center. pls advice me, what to do.
Hi
. My bike was giving a mileage of around 50 nut now a days this has gone worst it is giving 30-33.My mechanic says he needs to change the carburettor to increase the mileage. Please suggest me what to do…
Good to read this article. I have Bajaj Wind125 June2004 model. I have completed around 96,000 Km so far.
hi i also owns the same
and i have also same problem here,
so do u got any solution for this problem
please Reply me on shrikrushna.wagh911@gmail.com
Thanks
Hi All,
It’s Good information for who want to purchase new bike,
well i have Honda CBF Stunner old Version, Purchased jun-2009.
My bike giving me 55-60 km/liter in City and 63km on highway.
I maintain my bike well not riding above 50 Km/h and changing Engine oil after every 2500 Km and check Air preassure as 33 in front and 37 in Rear Tyer.
Please do not take pickup of your bike immidiately it will damage your block piston and burn more fuel, ultimately it will effect on your fuel efficiency and riding pleaseure.
Thanking you,
Gaurang Patel
Vadodara.
I ve an Rx-135 4 speed 1999 Model. Fitted with Expansion chamber and 2 times rebored the cylinder. I get a Mileage of 40 in rash driving(Above 100 kmph) and near to 45 in normal riding. And I get a pretty gud top speed of 120-125 kmph.
Hii Brother. .i’m Abhi i reside in Mangalore.I have A 1995 Model RX-100 whch gives around 24 mileage per litre.I asked a local mechanic on the mileage problem, he said changing the Carburetor Mite work it for you.Can you help me with this Problem ? Is ther anythng I could do fr Getting A higher Mileage. Plz Help Me. !!
hi all
i have a bajaj pulsar 220 fi,it gives me the milage around 30km/ltr.is it ok.can I expect some more milage from it??????
My pulsar150 2010 model is returning me 60 km/l given that my office ride is along a neat traffic less road. I take no special care maintaining my bike, but change oil perfectly. Also petrol bunk is un changed, it is the most trust-able bunk in my town. I hit 5th gear in 34 kmph speed, slowly gets it to 40-45, keep it there. Not just that, my ride is 30% city drive also, where heavy traffic, countless breaks need to apply. So over all combining the two, 60 is a good figure
Hi folks. I am from Chennai and i got my cbz-x sports red colour bike just a week ago. I already covered 550 km so far since i travel 100 km to and fro between home and office. This is my first bike and i am really happy to have this bike. With the bike still due for its first service i am getting a mileage of 58-60 km on an average. My daily commute includes 70% on highway and the rest in city traffic and i drive at an average 50 kmph. The only problem i am facing right now is with the gearbox. Its pretty stiff and hard. Even getting occasional gear jam. This is very annoying especially when i am stuck in the middle of heavy traffic. Before getting the bike i read in the reviews that cbz x has one of the smoothest gear boxes. But this is not the case with mine. Can anyone please suggest how this can be fixed.
Hi,
This is anand here from Chennai.3 month back i purchased FZ 16 black colour. Showroom people promised a mileage of 45 Km / Litre in city. But i am not getting that mileage now. Before 1st service mileage was around 40 Km/L in city and now 2 services are already gone and i am getting only 30 Kms/L and not more than that. Can any one help me out ? wat can be done here? going back to service centre is the only option or any other remedies???
Dear fellow bikers,
One more point to add to my last comment. I am getting frequent gear locks during sudden deceleration from an higher gear. At times of hard braking, i am unable to shift to lower gears unless i stop the bike and move it a little backwards. I checked with the service center guy and he informed me that this usually happens with all bikes. Is this true?.
Please advice.
sadiq..
am not sure about HH CBZ xtreme, cos i never took a ride on it and to be frank to u i dont like.
i own pulsar 150 UG 4.5 the latest one. though pulsars are famous for its gear problem, i also faced the same issue u mentioned. but try to reduce ur gear when u are almost to hault ur bike to 0kmph from 10 kmph, while u drop down to whatever speed u were. u cant just stop to nil movement as that will skid and u r on the ground with ur bike. hence i consider ur hard braking is to sudden slow down. so when ur speedo needle dropping near to 10kmph try reducing ur gear very fast..
i have honda activa
make year:2009
has one 2700 km
advice how to improve mileage of my vehicle i drive it in city only
does holdin d clutch durin slopes causes any excess flow of fuel???? plz reply !!!
Hi,
I bought the Honda CB Shine on June 2010. First service is over and now am facing the problem Gear struk up while changing 3-rd to 4-th (Vice Versa) and mileage is very poor. it gives only 40 km/lit. Daily am travelling at least 38 – 40 km. Please help me this.
Am also from Tamilnadu only.
i do have herohonda passion plus(2009 dec) which gives me mileage of 62-67 kmpl…..
Hi,
My Pulsar 150 2007 model. Can any find out the milage I am running my evryday from Monday to Friday 35 Km a day and every monday I fillup my tank for Rs. 200/-
My email amitpatls@rediffmail.com
Bajaj XCD 125 dts-si
city-70 kmpl
my avg speed-45 km/h
is the mileage good enough?
can u mention how much old is ur bike n the higheay mileage.09954230256
Hi Kaustubh,
It is something around 50. This is the good mileage for Pulsar 150.
Mine is giving 50-55.
I have Honda Unicorn 150 CC with Mac wheel model. i getting only 35 to 40 average in 1 litter. as per suggestion of my mechanic i have changed my bike piston and valve but still i getting same average. please tell how can i improve my bike mileage and tell me the corroborate air screw setting.
waiting for your reply
regards
Manoj
dear, mere pass TVS apache RTR 160 h iski average52 h
hey… i own a honda unicorn whose average was 55 but since 5 months it never crossed 35… many times i took it to the showroom… they have done all possible things to it… but was of no use… so please suggest me wat 2 do….
i want to buy tvs flame is it suitable for hiil ? plz tell me ?
hI GUYS..i won hero honda hunk n i servised it regularly even u can say very very early i.e 2000kms n it giving me a milage of 52in city n 55 or above in NH tat too i always drive it above 50,often my byk is at a speed of 90-100kmph bt thrz no diff in milage..i luv its performance..i luv my byk..isn’t its milage gr8??
Did you change the oil? Follow the tips given above and ride the bike smoothly. Don’t go for harsh driving or don’t go to race. Have an average speed of 50-60 kmph. Then you might get good mileage. Problem with bikes is, once you start getting low mileage, then its difficult to get good mileage.
hai sir 3 months back i buyed hero honda pasion pro self
it gives me 45 to 50 mileage how much we can improve this bick mileage give me some more more tips to improve it
only 45-50? I think this is a less!!!
my PULSAR 150cc , gives 50kmpl in local , and i haven”t tried on highways . its a 2008 model .
hi bro. i m Nitish. my bike is honda shine (model 2008) it gives a mileage just 35km in local and 40-42km in highway in one litre petrol.what can i do to increase its mileage?
hai guys,
i own a new pulsar 180cc dts-i UG4 bike,my buddy is 6 months old and have reached 4500 km till now, but mileage in city is only around 35km/l. i ride at a speed of 45-55km/hr in city and i highways above 70km/hr. can anybody suggest me how to increase my bikes mileage…………. and another doubt is whether K&N filter will increase mileage or not..and wats the cost of it…..
hi
i have a bajaj pulsar 220 fi,it gives me the milage around 30km/ltr.is it ok?can I expect some more milage from it?My avrg speed is 55 to 60.Please give me the correct information.
Hi,
This is pavan. I recently purchased the Yamaha crux bike 2005 model. It already crossed 35,000Kms reading. Now it is giving 40kms mileage. Suggest any tips to increase the mileage
Dear pavan,
Always dont change petrol bunk..
I always Prefer only Indion OIL.
Because BP Petrol are always heating up the Engine.
To test our bike with petrol it is not testing station.
So please use only Indian OIL.
Change the Spark Plug,Check the Clutch quality,Chain & Sprocket and lubricate if required,Tyre and Air Pressure,recomended tyre size.
If not u can very well contact me at pkk_kunna@hotmail.com.
Don’t alter any spare parts which was not recomeded by company.
Dear Karthik,
Thanks for ur valuable advice. I will follow the tips. If any suggestions i require i will contact to ur mail id.
Thanking u,
pavan
Hi
i have just purchased a Hero Honda Hunk on 16 sep 2010 and i like it very much and the bike is smooth and has good pickup and very stable i have finished 211 Km in two days…
But i have a small problem when it goes from 3000 to 4000 rpm there is a little jerk or some jerk that you feel when you shift the gear without closing the clutch. this is bit low to notice but am very keen on handling and performance so i check for all possible ways to keep my bike fit…
i saw the comments all are nice and thanks for the advice i think i will go for indian oil or shall i try shell?? cos my engine is heating a lot and it doesn’t cool down to easily so is this ok or do i need to wait till first service which i think might be this monday just five days from the day i bought….
reply me ok thanks….
and one more thing…
i just want to know how to get a good mileage or like tune my bike to a good condition both mileage and same performance that i get now as stock… since my riding style is a bit fast what speed should i maintain to get minimum of 50+ Kmpl and what fuel is good for bike shell or indian oil? the way i trottle is steady and slow only so just want to know if 50 or 60 is good for long ride……
Hi all
i have purchased a Pulsar 180 ug4 the bike is smooth and has good pickup and very stable . i need an info on what should be the approx mileage should i get
hi
i bought a yamaha FZ-S 2 months ago, nd i m getting average of onk=ly 30 kmpl although i ride b/w 40-60 kmph…..
but ride quality is awesome…..
it goes straight at even 80kmph when handle is left free…
after sales service is horrible ….
i got a relly bad behavior from my dealer ‘SEHGAL MOTORS’,MEERUT(U.P.) and even thair machanics are arrogant….
which is an authorised dealer and service centre….
yamaha must watch their dealer’s beavior….
hi ahlawat,
call this number at yamaha india +911206774600 and tell them your experience with the dealers. im sure they will take care of it.
Hi all,
What is the fuel reserve capacity and the average mileage given of Yamaha crux. Please give the information.
pavan
hi friends,
i have planned to buy suzuki Gs 150r but my relatives are critizing me to purchase Gs 150r as im skinny. im also looking for shine or stunner or unicorn or any other.im 5.8ft and 65kg of weight. help me to find a bike suit for me. i drive moreover long trips and city rides only during weekends. Recommend me a bike comes with mileage,performance and low maintainance as usual. im not looking for a sudden pickup bike.
Hi,
I Wonder if someody cn help me or guide me better !
i have been using KINETIC HONDA for last 6-7 years and no have purchased Honda Activa 2007 model, The seller assured me milage of 50-55 kmpl in traffic as he appeared to have taken care of the bike very well however to my suprise i HAVE NOTICED that it doesnt give me an average of more than 32kmpl which i far low than was promised, previous seller mentioned to me since i have been using kinetic honda so i must be using activa with the same style, is this true that any previous vehicle can accustome you that much that it impacts the mileage of new bike..i tried filling 1 ltr petrol and then again checkd the mileage which was again same close to 32kmpl, people then advised me not to ue just 1 litre quantity, advise me what to follow to increase mileage as mechanical terms appear jargon to me…
Hi
My husband owns a Hero Honda Splendor (2006). He always complains about low mileage. he says it gives only 20-25 kmpl. He takes atmost care towards his bike than me!! he has got all the services done well before the mentined time fearing of the drop in mileage. he is very upset with this issue. one of this freind suggested him not to fill the tank full. so he fills only 2-3litre petrol at a time. what he can do to increase his bike’s mileage. please tell me…. pleaseeeeeeeeee…
may be he is a rash driver or the engine comes up the boring period(mechanical complaints)
thanks
akhil
Ask him to raise this concern with the service center people, If it did not work then ask him to check with a local mechanic. most of the times local mechanic’s work far better than a mechanic in service center(only reason: local mechanic has a fear for his business cause he is the only owner) at least in my case local mech did great job in bringing my bike’s, Pulsar 220Dtsi’s mileage from 19 and 20 to 45+kmpl. stupid Bajaj service center people don’t know how to tune a carburetor for optimum mileage and performance. to that matter lacal mech also did not tune it for something that I want. This made me learn how to tune it and after a month I am successful in tuning it for something that I need. now my P220 is returning 45kmpl on long ride(city ride not yet tested) and engine sound and performance is also good. Thanks to Deepak Raj; site owner, who helped me in gaining that knowledge.
My pulsar 220 is giving around 20-25kmpl.It done 2500 km with only two services are done.Speed varies from 45 to 80 with daily run of around 15kms.Is it O.K.
tel him to sel the bike and ,perchase a cycle.
Hi ,
I have yahama libero city cruser . my bike is in gud condition . i do regular servicing of bike . The major problem is . i get very inconsistent milage . Some times i get 70 some time 65 some time 60 . Couldnt figure out what is that because of which i can make it consistant and that to on high end (70) some times my bike has given milage of 75 also .
As i have read above posts . I will use the tips you have given to warmup the bike .
Hi..!!
Few days back bought Splendor + and have run only 300 kms, and wish to know the valuable facts… which I must follow to get the new engine in good going….. what should be ideal speed for new engine and upto how many kms, I need to be limited with speed…(presently I run it at around 35 kmph…
Usually I put 4th gear in around 25kms speed (of course, raise throttle very slowly).. is that right idea… Or I should put 4th gear on little higher speed…
Kindly advise….
hi..
I have splendor+, the global advise is don’t raise the engine more, keep the speed limit under 45kmph for at least 3000 kms.
hi guys i hav a pulsar 150 and i want to know dat can i install the k and n filter directly to the carb.i.e, without cutting the stock air filter box ill remove it completely please help me
hi guys i wats buy abike which gives 60& above mileage , 150cc , low maintainance, stylish, … so please help me….
u can go for pulsar 135 or honda dazzler
Hi,
Prabhat here. I have Spl + from last 2 months i have ran with 850 Km and i done with 1st service at 750 km.Initially it was giving me 65+ mileage but now it is less ..i mean how to improve bike mileage.
What are the basic tips need to taken care.
Deepak and team you’ll r gr8
Thanks a lot for getting all info about indian bikes into 1 site…
Appreciated to the gr8est extent…
Wish you wer in mumbai
Coz i want u 2 ride my CB unicorn purchased in may 2010 which gives a mileage of only 40 even after using power petrol…
Have rode more than 2000 kms
I ride 95% below 4 rpm and 75 % between 3 and 4 rpm..
tried increasing tyre pressure also but mileage increased just to 42..
but my pick up is better than a few unicorns i rode
hai deeps
i am new comer of this site ,it is very useful,i had pulzar 150 cc i dont know what is tuneing engine is it good for bike ,sometimes i get good mileage but sometimes very bad my speed is 50_60,.
Hi all ,
i own A honda unicorn (150cc) 2009 model. The mileage in city is 44-46 km / lit.
Recently i have done the engine flushing n servicing to improve mileage.
Could anyone tell me what to do to increase the mileage? I use SPEED(BPCL) petrol in my bike.
Could following measures will increase the mileage?
1. Chain Setting.
2. Reducing RPM from 1000 to 800.
kindly advice
hieee
i own karizma r red colour,
i am gettin 35 kmpl in city,i wanna to fit k&n filter to it,
can any one 4m hyd suggest a good specialist in karizma……
thanks in advance
i have a yamaha fazer mostly in the morning i get late to clg and drive rash…but else where i ride it in the range of 40-60 still i get just 30-35 as the mileage how can i improve it more
Hi Guys,
I have passion plus (2007 model) crossed 34000 Kms..
my bike gives an average of 65 to 68kms… at an average speed of 40-50kms…
can anyone suggest what is the avg kms for bike service ( free 6 + 4 service over).
bcoz i am confused HH service centre guides me to do the service for every 2000 kms ,
but i think doing service in every 2000kms is mere waste bcoz 2000kms will be acheived by me in just 1 and half month…
so can anyone help me in this???
i am amar, i have passion plus 2008 it gives only 48 km per litre pl help me how can i increase the average
my id:amarsurya90@gmail.com
Hi,
1. replace rear tyre to splendor+ thin tyre
2. clean airfilter with kerosene
3. replace spark plug or clean with petrol
4. kerosene wash and dry chain\sprocket
5. keep recommonded tyre air pressure
6. for mileage check ride your bike 45km/hr
7. check free idle free rotation of both wheels
8. clutch adjustment should be standard
9. genuine (HMSI) HONDA 4 stroke engine oil for test mileage for once
10. replace lock petrol on\off cock
11. check for petrol leakage from petrol tank to carburetor
12. check silencer free flow of exhaust air
i have passion plus2008 it gives only 48 mileage pl help me how can i improve the mileage
I have puslar 135. It gives 45 kmph both in highway as street as well… its strange…
I’ve a xcd 135.
it gives about 60-70 / liter.
Nice post.
Friends,
i own a SUZUKI GS 150R
The mileage i got before the first service is 60.23 in Eco mode and speed was less than 60 and RPM is 4000
After the First Service, i got a mileage of 52 in Power mode and max speed was 75 and RPM less than 7500
After the Second Service, i got a mileage of 52 in power mode at a max speed of 78 and RPM less than 8000.
I will update you people after my third service , but this time , the Eco mode mileage .
Regards,
Krishna
hi i m rohan i have a honda unicorn and i m getting a mileage of 40-47 now. before i got from 50-55 in city rides. how can i increase my mileage
hello.. i own the bajaj pulsar 150… my bike gives me just 35 kmpl.. it is very strange.. its been just a month buying this brand new bike.. can you suggest some ideas so that i can increase my mileage…
i have Royal enfield Bullet 1978
i usually drive 50 – 60 kph
my bike milage 35+kpl
but in full tank condition it lowers 3-4kpl
what is problem ?
hi,
i have bought a honda shine around 20 days before and I ride at an avg. of 30-40km/h but i get a mileage of only 30 km/litres/
plz give me some tips to increase my mileage
thanx in advance
hi. I hav fz16 and i m upset wit the milage it givs me 32km/lt. I wnt 2 increas the milage so pls giv me tips.
I ride bik around a speed of 60+
i am use in honda twister, i have already run in 50-60km/h. pls tel me what type maintain in my bike?
I brought 150cc pulsur 2010 sept model .but my bike gives 40 milage i can’t maintain .give Me best solution for my bike
i am having CBZ super sprint.upto last month mileage is 45 but nw it is 40.so wat i v to do to get the mileage as before?
hi sir , i am naveen i have hero honda hunk 150cc , it give 40 km per liter . so i am not saitisfactory with this . so i need tchniques on driving and in bike to improve milage plzzzz suggest .
hello deepak…
my discover135 gives me 50km/l in city……in future i will follow ur advices…..i wanna ask——AT WHAT RPM SHOULD I CHANGE GEARS?
usually i change the gears as written below-
1st gear—o-12km/h
2nd gear—12-20km/h(sometimes it goes upto 24km/h)
3rd gear—20-32km/h
4th gear—32km/h
IS THIS GEAR SHIFT PATTERN IS OK OR NEED ANY CHANGES?
PLEASE SUGGEST ME……HOPE U WILL ANSWER
PRIKSHIT
my bike is 1.2 years old…….
hai deepak, i’m getting a under 50 kmpl for my new stunner 5000 done bike,what i do for improvemet, allways riding in between 40-60 no sarre guard, crash guard,vibrations also there, realy uncomfortable after 6o km throughly disappointed
hai .. i`ve honda shine for past 1 month..it gives milege 55km/ltr…
hi i am planning to buy a good n handsome bike…wich must give high mileage….
can u recommend me a bike model pls…?
wanted to know an important thing .. Sudarshan, Deepak anyone??
someone wrote that if you fill your fuel tank full, then you might get less mileage, due to the pressure build up.. Is it true.. but then no one can fill up their bikes full. i mean performance bike say R15 has only 12 litre capacity and obviously you won’t be getting 50 and above in R15.. so wat do you do? fill petrol every hour??
how can it be that full fuel tank gives less mileage that is wat a 4yr old child can think.. but this is a machine, not that if a mug has a hole at the bottom then the more water it has the faster it will drain.. plzz clarify!!!!!!
prasanjeet, thats a very good question. I read almost more than half of these to see the true mileage of bikes rather than to hear what manufacturer says.
I too noticed the comment that you are questioning about.
I give you a quick and simple example, try to relate it to your bike.
If you notice F1 race or any other race racing sport like Moto GP or the nascar racing, In the pit stop if you notice the fuel filled is always according to the number of laps remaining. suppose there are 20 laps to go they never fill the fule for 50 to 60 laps. this is because the weight of the vehicle increases and thus results in overloading that required.
I guess u understand what happens to a vehicle if you overload it with anything.
Example I gave you above is acceptable in races cause for them even 0.001 second matters a lot but when it somes to bikes in city its just you have need to trottle bit more to reach the same speed.
even if the logic that I gave you is correct I too do not agree that a full tank and a half tank gives you a difference of a kilometer atleast.
If that really matters in mileage then people have to ride empty stomach than full stomach.
removing saree guard, half tank fule, empty stomach all togather might give you a difference of a kilometer or 1 and half.
By the way Bike details I am using:
)
Bajaj Pulsar 220 DTSI(carb version)
mileage 44 to 47 (always fluctuates in hyderabad)
Mileage in Vizag/visakhapatnam 30 to 35 in city on highway 42 to 43kmpl.(no idea why?
sometimes mileage fluctuates so badly from 19kmpl to 39kmpl because sometimes I had to travel in city(only 3rd gear or 2nd gear if my
mom joins me for a ride I can not take more risk with my beast.
I lover riding: I drove my way from hyderabad to vizag(700km) after 3k km and 2nd service. Almost every month I drive 150km without any hault.
I never followed what Sudarshan suggested but after reading this article I realised that traffice conditions in hyderabad made me strictly follow, what Sudarshan suggested, by default.
Friends anyone else with more mileage that 44kmpl with P220 DTSI(not DTSFI) please let me know… I like to improve.
MILEAGE TIPS:
1)RPM reduced to 1K initially and after driving for a kilometer when I stop at signal point because engine gets heated RPM automatically raises by 300 to 400rpm so I reduce it down to 1K again. similarly dont forget to increase it when ur stopping ur engine if not u may fail to start it again(cause of very low RPM after engine cooling down)
2) P220 has semi automatic gear shift This makes you very hard to get it back to neutral whne the engine is running. Just switch off ur engine and it tends to be neutral so signal points play major role for P220 mileage. with clutch and in first gear vs engine switched off and neutral so P220 users decide urself.
3) automatic choke so no worries at all if ur rpm is correct.
My driving style:on P220DTSI
I always shift up the gears at 4k RPM and rest all my bike takes care.
1st gear – 0to16kmph
2nd-16 to 26kmph
3rd-26 to 40kmph
4th-40 to 50kmph
5th-50 to 65kmph. P220 engine sounds perfect at 65kmph on 5th gear. I usually travel at 65 to 75kmph. top speed I saw is 134kmph.
Longest travel without hault 400km.
longest distance covered in single day 700km.
LOVE TO RIDE—Venkata Deepak
Hi ,
I bought my bike, Hero Honda Glamour (2007) in Kolkata. Currently am working in Hyd so have brought the bike here. The bike was giving a mileage of 60 in Kol but here in hyd its giving only a mileage of 35-38 at max. I have serviced it twice but is getting the same result . Can you please advice me on this ?
Anand, which place in hyderabad, I am asking to know how the traffic is at the places where you drive. which gear are you travelling in mostly? I dont get a chance to travel in 3rd gear also on my Pulsar 220 so asking to know? Do you always travel in peak hours? and at what speed you always like to ride your bike? did you personally notice any difference in your riding when in Kolkata and in Hyderabad? for how many days you left your vehicle unused if you did so?
I am asking you all this question not just to suggest you something but also to improve my knowledge.
By the way make a note of your mileage by change the petrol bunks also. some times I dont know why but some bikes does not give good mileage when you buy petrol of one bunk but still your friends suggest you that petrol from so and so bunk is giving you good mileage and all nonsense.
I personally experienced this bunks issues with my dad schooter and my friends bike. so I decided not to go for petrol of that specific bunk.
Any how this is my personal openion. just give it a try.
Hi Deepak,
Thanks for replying to my query. I currently stay in Madhapur and travel to Gachibowli Deloitte office daily, its a distance of 9kms only. I normally travel around 2pm so the traffic is not an issue in my case. I normally travel between 50 – 70 kms/hr. However I think there is a valid point of not using the bike for several days. Infact when I shifted to Hyd back in Feb 2010, my bike was left unused in Kolkata till July 2010. I brought my back in Aug but again went back to Kolkata,due to some family medical emergency,in 1st week of Sept and the bike was again left unused here for another 1 and half months. Kindly let me know your suggestion about this and yes last night I filled in 10lts of petrol from a different bunk.
Thanks again !!
Ananda
Anand, I am not an expert to suggest you something. Actually I am trying to understand the problem in detail and also like to here a good solution for this issue. I wish if any expert explains this issue.
I suggest you only one thing; this time visit a castrol service center. explain your problem in detail to them and also ask them to test your bike’s mileage.
try your luck.
hi im the proud owner of HONDA UNICORN it gives a mileage of 58 in city and upto 65 on long drives…:)
I have just bought honda cb TWISTER n people said that after FEW WEAKS its milaege will decrease bt by following these awesome bt small tips which can be easily followed i m getting “65+”milaege in CITY ROADS where i have 2CHANGE GEARS a lot n on highway it gives an amazing milaege of about “70+” around “74-75″ which IS ABSOLUTELY JHAKASSSZZZ AND it miles around “79-80″ which is jst UNBELIVABLE because the COMPANY ASSURES that the bike would mile around “70″ on highway BUT mah bike is giving “”"”"10kms+”"” WHICH IS JUST~~~~~~“AWESOME~~~““““““`THANKSZZZ 4 UR TIPSS BRO
i’m having a honda unicorn. Can any 1 help me in increasing its mileage it gives 30 in city n 36 in highways. Plz help me. Jaldi….
I have discover 125cc and it give mileage only 35kmpl,please help and reply soon what i do
hi frndz am using pulsar 150 2004 model my bike gives around 35-40kms but at tyms it gives 55 also why does this change occurs and give me some tips in maintaining also… just now i changed the bore n piston but now too am getting white smoke can u tell me the reason…
hi guys…
Got a Fz around 5 months back(my first motorcycle)….had a moped bfore…..Now theres one thing, that i rode motorcycles of my friends…but not too much…the gear thing was still rather new to me even after i got Fz….now its ok…i feel im doin things right….bike handles like a gem…but its the mileage…its about 35km(after 3 services)…but my friend’s Fz gives 45…I think its my gear shifting ratios, thats causing this drawback…Can any of u advise me…….
hey am planning to buy unicorn second hand 2006 model ….but little confuse with milage of unicorn …am confused with pulsar and unicorn …please help me …also wnt to know can we improve the milage of vechile if milage is less…its urgent please reply
Hey Sudarshan,
I’m buying new Pulsar180 DTSi UG4 model.
Had a few questions.
so can u mail me if u dnt mind answering dem at “Shashidhar_Dhondye@infosys.com”
Thanks
hi,
I’m sree,am using CBZ xtrem 2007 model,my bike give 40km/1 liter.
I think this is not good a maileage for my bike.
hey i m owning a ninja 250cc
it gives me hardly 20km/ltr…..
i tried those methods even still getting the same
Hi all…Am owning a Bullet classic 350. Am getting a mileage of 51.7kmpl.
I handled my bike smoothly during the break in period and i have kept my idling down .
Regards,
Prakash
hey prakash how can u get so much mileage when i m not able to cross 30 kmpl with the same bike..im fed up with that mileage i wanna change bike but i dont wish to give it as i loved to too much..please give me tips how did u keep ur mileage so high??it is impossible to get 51 kmpl that too in bullet….tell me how??
hi,
my name is harsha i using bike bajaj discover 110cc i buyed in 19th january in this year 2010,its give mileage in cities it give me 70 to 75 in highway it gives 80 to 85
it has problem,in now a days in early morning a starting problem in winter session when buy in january same problem i have like that only. what i must do ?????????? give some suggestions…………..so u can mail me to kollurisriharsha@ymail.com…………..thankimg u to all for giving me your valuable time for me,thanks to all of friends………
from,
harsha………
i hve bajaj pulsar 220cc dtsi……n itz fcuking me by giving 26kmpl…….help me out
hi i have honda stunner , its 125cc but intially it gave 50 after 2 yrs it gives mileage 30 to 35 only .. my friend also having same bike 1.6yrs that too its giving 30 to 35…. i hate honda nowdays , plz tell me how to improve mileage
I own an Apache RTR 160 RDF Carb version. I bought it 4 months ago and now its 6500kms and three services done.
I get a fuel efficiency of 59 kmpl in city and 64 kmpl in highways.
The tyre pressure i maintain is 26/36 than the standard 25/35. I was surprised to know that tyre pressure lower by one or two points decreased the mileage by 3kmpl.
The speed i maintain at highways is 60 kmph exactly. I always ride with a light right wrist.
I’ve tested its top speed once (118 kmph) and cruised in highways at 90kmph. It still returned me 50 kmpl.
Its bad on my part to ride the fastest bike in its segment like this. But the money for my fuel comes from my parents and i’ve got a year more to get a job.
Hope this would be useful for people like me owning a beast and expecting high fuel efficiency.
TIP: Please check your mileage with atleast 7-8 litres which will show the average. If you need any more info, mail me at saransnmv@gmail.com.
hi friend,
i have read about your reviews of apache bike.
hallo,
my name is harsha,
iam talking from vijayawada.
i am using bajaj discover,i have problem with is startin problem in this winter session early morning can u give me any tips for me.
hai i have yamaha fzs it give 44 on highway how to improve my bike milleage my model is midnight special i want my bike look palish i using only speed petrol
FZs giving 44 is not bad yar. Its because of the rear tyre which creates more contact with the road surface.
So, more the contact, more is the grip. more the grip lesser the returns. This is the same reason why the same engine of yours gives more mileage in an SZ.
Gear ratios:
For better fuel economy
shift up after 3000-3500 rpm
shift down before 2000 rpm.
Maintain tyre pressure as recommended and check it twice in a week.
Increase the throttle gently and always have a light right arm.
Dont let your engine knock and dont open the throttle suddenly.
If you follow these, your bike will have a bit of less pickup but will give good fuel economy.
I dont think speed petrol would do wonders. The problem with us is calculating mileage of the bike.
If you say you get more mileage using speed petrol, did you ever think you are spending more for every litre of fuel you use?
MY ADVICE:
Please calculate “per kilometre cost”
i.e., If you put normal petrol for Rs.200 and your bike runs for 150 kms, your per kilometre cost is 1.33rs.
But if you put speed petrol for rs.200, you’ll get less fuel (around 50-100ml). You’ll probably run only 140kms. now your per kilometre cost is 1.43rs.
No harm in using ordinary petrol for carburettor run bikes.
Please use Ordinary petrol and refuel always in same petrol pump. try to maintain atleast half tank of fuel always. Trust me… You’ll get more mileage.
Try all these and send a reply to saransnmv@gmail.com. Good Luck.
please gear shifting ratio for yamaha fzs
Hi Brothers I Have A Hero Honda Cd100ss model 1984
and still running condition it gives 67-68 in city in high way 72 milleage so cool na i drive rough i touch 60-65 speed in my meter thanku
Hi.. Fida Khan… nice to know that u r getting such a fabulous mileage from yr bike… it’s give more pleasure.. when we see petrol prices go up every day… just take care of yr lovely bike..
thanks bro Raj
Hi bro it seems my new pulsar150 is kicking ass on mileage as it gives 55-60 and 60+ on highways..!!!!
remember carry the same rpm range for each gear shift DONOT rev the engine too much on lower gears
P150?? 55-60 and 60+ on highway..!! good to hear. very less people get that good mileage.
Hi Saran,
noted your tips for improving mileage…
I hv one question… earlier I was having Splendor model 2003.. in it’s early days it gave me mileage of 66-68 kmpl… and lastly it was giving me around 58 in city..
Now I hv new Splendor + (just crossed 1000 km reading)… but it never gave me average of above 55… usually it comes b/w 40-52… I do not notice any change in my riding style.. in fact with my previous bike I used touch 70-75 kmph… but with my new bike I never cross 45-50….
can u help me to get good mileage from my new Splendor +.
Had it gave problem r any sound in engine just test whats the sound if tap sound fix it ok
one more suggestion bro if you didn’t hear any sound have you changed your engine oil
just a trick i used to my bike in corroborator their is a scrow like idling just down their is a same scrow just turn it back 2 1.5 percent ok
Hi all,
I hv buked Pulasr 180 UG4 model.
Will get it in probably 1-2 weeks…or so…
Can any 1 put some light upon gear shifting ratio of P180 UG4..? (i.e optimum speed range for each gears..)
Also, wat is the mileage…? & tips to increase the same..
& tips about maintaing d bike in its initial dys…
Any tip about maintaining / anything related to it is most welcome..
Thanks all in advance..
gud day..
Njoy..
LIVE FREE…
RIDE HARD…!!!
my pulsar 150 DTSi 2010 has loud engine sound and low pick up.
please let me know how to slove it.
Please help me……….plzzzzzzzzzzzzzzzzzzzz.
hi sir……..i hav got splrndor+(spokes wheel) 2007 model……….i usualy love to go for long drive but i get very low mileage of 50………which is costly n hectic for me to stop in between my ride n fill petrol……….so can u plz send me any ideas to increase the mileage……….n also i have got other bike yamaha YBX 1999 model but the mileage is only 25 which i have alterd like a dirt bike…….can u send sugesstion plzzzzzzzz
Thanks a lot SARAN…for ur advice….ill put them to use n try…….mine is an Fz as i mentioned!!!
HI,
I have a Super Splendor bike of 2006 model. However I am getting a mileage of 42-44 kmpl. Any idea of how to improve the mileage??
hi i hav planned to buy a bike wich must give high mileage…can u giv a bike suggetion??
Good to know Mr.Vignesh. Please send your purpose, driving style, etc.,….
Your height?
Age?
Where you you reside? city or outer?
Type of bike you are expecting?
Your Budget?
Which segment? 100cc / 125cc / 150cc / 180cc / > 180cc?
Is style an important factor for you?
Average distance traveled per day?
City or highway traveled the most?
Have you shortlisted anything as for now?
Please send these info…. I’ll definitely tell you one which will suit you the best?
height 1.59
age 23
city
budget no prob
150cc
ya style is important
50-60km
oly city
apache and pulser
Good article about bike mileage.
I’m using TVS APACHE/ 160CC/ 2010 MODEL/ CURRENT MILEAGE 45 TO 50KMPL.
I would like to improve my bike performance, if you have any suggestion pls let me know.
hi dudes iam having pulsar 150 cc it gives 65 in city and 80 in highways maintainence of bike and constantly changing the oil and giving a little bit of throttle .
Hi ,
I am having pulsar 220c which i bought 4 months back and it is giving just 30kms mileage in city . could you advise me whether i can able to increase the mileage of my bike…..
hi…recently i bought hero honda cbz xtreme…it’s gives onlu 42-45 in the city & 50 in the highway…but some of my frd’s said that they figured up to 60…how it’s possible….if any scope plz mail me….i’ll be in touch with u..
hi…i recently got the Unicorn Dazzler from Honda. its 150cc & is giving a mileage of 50. is it fine
i have Stunner cbf-2008. completes almost 40,000kms. bike is currently giving me the mileage of 58-60. but performance is not so good now. service center guys said that its time to change to piston and do other things in engine. what’s that means? also i want to change rear Tyre of bike. size 100/90-17. can i use other size (heavy) or it is best for it? also which Tyre is overall best, tubed or tubeless?
i have fz 16, gives me about 34-40km mileage. but when i took long ride abt 600km, it gave me 52 km mileage. it is awosome.
KarizmaR Oct,2008 run around 15k kms. Stock front and MRF Zapper Q 120/80-18 rear, iridium plug with motul engine oil getting 35 km/pl consistently in Kolkata city traffic (needs more clutch use & occasional acceleration) using normal unleaded fuel. Not driven on highways though.
hi,i have a mileage issue on my p150 ug 4.5 ,actually i put a fat tire 120/80 after that it suddenly decrease to 38 from 54.i keep my bike in periodic maintenance but nothing happening, any suggestion.
hi ……my name is kumar i stay in kalyan city………..i own apache 180 and i get average of around 30 kmpl in city…didnt check on highway…..plz give me tips how can i get average at least more than 35 kmpl…..plz sent me ans on my mailing address……plz help…
hi deepak , I am planning to buy a bajaj pulsar 220 cc ….. Plzz tell me dat how much average would it give in the city…. and also some other option in this price…. plzzz email me urgently… my email id is ayushjazzy@gmail.com
I bought platina in 2007. First two years it gives mileage of 53 KMP, but after that Now it gives mileage of arround 45. Most of the mechanics are failed to sortout the proble. I’ll grateful if anybody can give any tip for that.
i have bajaj xcd…since starting (18 month) i am getting 40 to 50km/l…..please advice me what to do………..thanks
hey guys … wish all of you a very happy new year
I got my dream bike ie a pulsar 150 on august 31 this year …
i ride it very smoothly with no rash cuts initial it came around good with a mileage of above 60 kms per liter of petrol on combined city and highway conditions … even after first servicing the mileage did not change..but since i gave it for servicing for the second time … i am not even getting a mileage of 40 kms … i am not able to get what the problem is …
I ride to my college which is 65 kms away frm my house on my bike usually i fill up with one liter and come back home with out refilling
but yesterday my bike stoped even before i reached home … luckily der was a petrol bunk nearby or else i would have to push the bike for 3 kms
sory my college is about 30 kms away
the total distance is near 65 kms
hI,
Mine is a Pulsar 180 UG4,which gives me a mileage of 49-50
Hi Prasool,
Me to got Pulsar 180 UG4 on 10th DEC’2010.
I think ur mileage is gr8.
I haven’t measured my pulasrs mileage. but will like to knw..ur maintainence & driving style(i.e max speeds for each gear).
Also which petrol u use. I use HP normal unleaded.
& any tip about maintaining or anything is most welcome.
thanks in advance.
byee..
hey hi!
iam Ram
recently i brought pulsar 150 (14-10-2010)
within 20 days the bore of my bike has gone……
they have replaced at 700kms under guarantee….
now my meter is at 3500kms but it is giving 30-35 mileage only from the starting it is giving that much mileage only……
please help me with a suggestion…….
i have a hero honda cbz exteme 1500cc it gives me a mileage of 35 in the city. how to incrag my mileage?
Hi Deepak
I have Splendor Plus bought it Sep 2009, I have completed 2nd free service in Nagappa service center, after 20 days after the first service my bike makes hard to move above 40KM/hr speed it makes more noise and hard to move and even after 2nd service the bike is producing more noise. Can you pls help me how to maintain it good way and give the previous smooth and comfortable ride. What i need to do?
get it tune by the service people .. my bike also had d same problem
its fixd now
hi frnds. i have a yamaha gladiator type rs. means 2009 november model. it is giving me an avg milage of 45-47km/lt even if i ride it very carefully. and once i have gone a long tour on highway. i maintained a speed of 90km per hour and my bike gave me a poor milage of 36km/lt. i think it is a very poor milage as per as a 125cc bike is concerned. so plz. suggest me any tips to inrease milage …….
hi sachidananda,
even i too have yamaha fazer 125cc,, 2006 model…
when u go overspeed, the petrol will go like anything…
i used to go 80-90 with my bike… i just got 28 km/lit….in highways….
If u go at 50-60 , u can get very good mileage…
Hello Deepak !
I like to buy the bike which must have the mileage of 50-60 per litre atleast with gud looking and gud quality of engine. suggest the best bike to buy. and also is there any gud tool to increase the stock mileage if yes please specify…
Thank u.
I have passion pro bike i feel that my bike give v poor milege give me some tips. Is there any knob in bike i adjust the mileage.
i have cb unicorn . it gives a milage of 60-65 in city and almost 70 in highways
my cbz of 2005 model gives an avg of 30 in city…..n i think itz not enough……what do u guys think????
i have a honda stunner cbf its a 123 c c bike.i want to know whats the best average i can get.
hi i am vallimohan i am using pulsar 150cc 2005 model, i bot used one in 2006
i use to drive my bike cool… between 30-50 in side city i am getting 70-75 in highway i use to drive 70-80 i am getting same millage is based on driving and condition.
Hi…Recently i bought an second hand bike of passion plus((2008 model)..initially it gives mileage abt 50kmpl..but for the past 1 week my bike’s mileage suddenly falls to 30 to 35kmpl..i checked it twice…im not an rash driver..i used to drive the bike at 50kmph…What will be the reason for this abrupt fall in mileage….
I have Honda unicorn which i bought in 2007 sep and the problem is about milege in initial it gave 50 km per liter and it has gone down to between 35 to 40 kms.I am in chennai ,due to traffic/signals every where i often use clutch to control whther that is the prolem for low milege or some spares to be replaced to get milege.please advice.
regards,
Anbu
Hi my name is Nikhil i have a herohonda glamour its average is 50-55 but its pickup is bad
hi….thanks for ur advice………!!!!!
i am 6.3 feet tall i have got plans for buying some new bike that is very good in mileage and also in looks and performance………!!!
i went through many websites and im confused with honda stunner cbf 125cc and tvs apache rtr 160……..!!!!
pls suggest me some bike that will be sporty and also good in mileage…..!!!!
advance thanks…..!!!
waiting for your reply
ASHOK
I don’t find any confusion between these two bikes as they belong to different segments all together. If you put design and looks as your prime requirement, both are cool.
Apache offers you more gadgets like Digital speedo with 2 trip meter, high speed recorder, shortest time recorder, dual disc brakes, sporty riding position, LED tail lamps, pilot lamp, racing stripes, clip on handle bars, service due reminder, low fuel indicator, dual mud flaps, etc.,. other than the RPM meter, toe shift gears, engine cover, which is common in both the bikes. But remember you pay more for what you get.
Stunner is a stunner in 125cc segment. Cheaper than Apache, better in fuel economy but lags behind in performance. It gives you split seats and quarter fairing which is not available in Apache.
So, its up to you to decide on the segment to zero in on a single bike. May be your budget should decide. There is one more thing I left to mention, you said you are 6.3 feet, I dont know whether you will be comfortable with Apache. (I own an Apache and I’m around 6 feet. I dont feel any problem).
So, just go and have a test drive. I think Stunner will suit your height and requirements the best. Also look for availability of service stations and the quality of service offered by the dealers, etc.,. coz, after your purchase, that is one major factor you have to look into.
Please update me on your decision….
Hi Ashok…
May b u cn go 4 a pulsar…
Pulsar 150 UG4.5 gives a mileage btwn 53 – 58.
Pulsar 180 UG4 gives a mileage btwn 43-47.
(these are in cities in decent amount of traffic & u would get more on highways… )
I own a P180 UG4 & for me it would be a thums-up for it….
both d bikes look gr8..& are suitable to your req. in terms of height & mileage…
by d way what is d figure of mileage u are expecting..??
i would recommend to go for 180.. as it has gr8 looks… awesumm features…dat u will know after owning one…
so may b u cn tk a tets-drive & also consider these…
after all its up to you…
all d best….
also consider the factors put forth by Saran.. they are of utmost importance…
let us know abt ur decision…
byee
LIVE FREE..
RIDE HARD….!!!
Hi, My brother’s bike, i drove upto 1 week in the tambaram bypass including to chengalpet highway (55kms)to go to company at a speed of 45Kmpl.I surprised it gives 93kms per litre.Bike is splendour plus 2008model
thanks for ur suggestions………
SARAN $ SHASHIDAR
well i expect mileage around 55-60 and above…….
some of my friends suggested to go for honda unicorn 150cc……..i also read about its specifications and reviews as per their suggestions……it looks cool in design………!!!!
and….,
one of my friend is having honda stunner cbf….he said tht he feels sort of vibrations while driving above 60…….!!!!
and saran…..thanks for those info…..
you said you are using apache…….rite
could u pls tell me about its mileage… and is it good to go for rtr 180
and….thanks to shashidar for suggesting pulsar 150cc and 180cc…….
i am totally mad by its designs and looks….!!!
if am to select among this two i will better go for 150cc……!!!!
ya Ashok..Unicorn is no doubt a superb bike…. but I think there is a waiting period of 8 months for booking … & after booking some more months 2 get d delivery…. so it will be atlest a year to recieve it…
& if u r looking for mileage of 55+… i cn say dat uncorn isn’t d right one…as it wont b givng u above 45kmpl…
rather i guess it will give btween 35 – 43 kmpl… as far as i knw…
may b unicorn owners can hlp u out….
hey Saran i too want to know abt apache 180… wats d mileage…? & hows d bike as in overall package..
coz..i hv heard apache engine isnt dat good… & also der r lots of complaints…
wats ur experience…? design wise i like it… i hv rode it once..i felt d pick-up ws amazing…
hey ashok..1 more thing… cost diffrnce btwn 150 & 180 is less than 5k/-…
but it gves far more than u cn think..
check out d reviews of pulsar 180 UG4 on bike advice itself….
all d best…
true
coz my unicorn gives only around 41-46
obviously in city conditions
but dnt expect much even on highways
@ Shasidhar: Unicorn giving a mileage of 35-42kmpl?????? I dont know where you get these figures from??? With any hard riding at any speeds, i dont think Unicorn will give such a low mileage. May I know where do you reside???
i too have a cb unicorn april 2010 wen it just came
n mileage i get is around 41-45 n max i got was 48 once
n i hardly cross 4 rpm so max speed i reach is also around 60
@ Ashok:
Stunner : Yes. The stunner is not a good machine to ride at above 60kmph. Vibrations apart… But one bad thing about Stunner is that when you are riding fast, you will always search for next gear. Even at 50+kmph, the engine rev increases and you feel the need for two more gears.
Unicorn : Why do you go behind those which are not at your convenience? Its just my personal opinion. Dont get offended. Unicorn is a good machine – True. But waiting for the bike for nearly an year is a stupidest thing as there are many other bikes to choose from.
You could even go for a Yamaha SZ-R which is really good, really cheap, and offers you a decent mileage of 55kmpl which is really good for a 150cc bike.
If you are a person who wants a good mileage and do not like spending more for fuel,,, Please dont even think of anything above 150cc. Apache 180 will return a maximum of 50kmpl but remember, you can take on any other bike with it. If you want performance, you have to compromise on mileage.
My RTR 160 : This is one thing which I always try not to mention. But what to do? it is the truth. Believe me or not. I get a mileage of 57kmpl in highway and 54kmpl in city with smooth riding. With hard riding at high revs, I get a mileage of 50kmpl. Only when i drove at 120kmph thrice for totally about 30 kms, I got a mileage of 45kmpl. My bike is 12500kms done. Initially, during the run-in period, I got around 65kmpl.
Engine : Engine problems will never occur if you ride it in the way it has to be ridden. My dad owns a TVS Centra for about 6 years now. We have not yet got any complaints with the engine. But a friend of mine who owns a star city has repaired his engine thrice. So, its all on how you maintain it and there is nothing about the engine and all.
@ Saran : hahahaha…and please don’t get offended man…
I dont own a unicorn… I said wat I hv knwn from my frndzz…
if u read again… here is wat I mentioned :
” if u r looking for mileage of 55+… i cn say dat uncorn isn’t d right one…as it wont b givng u above 45kmpl…
rather i guess it will give btween 35 – 43 kmpl… as far as i knw…”
with a special mention saying dat : “may b unicorn owners can hlp u out….”
& they have replied…
i mentioned it from 35 as I dont think it will go below dat in normal condition….
ya..1 thing i hv to ask…
I hv pulsar 180…I got my first servicing done at 400kms..& i changed d oil…
nw wen shud i do another serving or an oil change..
Can any 1 tel plzz… any P180 owner…
Thanks…
byee
Hi guys……….
Am very confused about buying bike, Pls suggest any one of me, i am in chennai actually my regular travelling distance is 40 km, this is first time for buying the bike i don’t know which bike suitable for me.
I am very impressed about appache rtr 160, but my brother is confused me, that is not giving mileage , vibration problem etc… but i like that bike very much, please suggest to me its is worth or not???? please reply to mail id sathya_caddesigner@yahoo.co.in , please guys i am expecting your suggestion more…. i planed last 6 month back but due to this confusion still i didn’t buy any bike. pls suggest me which is suitable for chennai road. i want atactive with giving more mileage bike pls pls pls pls pls pls pls suggest me,,,,
Advanced Many thanks for suggestions,
sathya……
I have avenger 220 but I am not able 2 get gud mileage. For 1liter it give me only 32.
Plz recommend me some tip’s..
Regards,
Dani…
Hi Guys i am using Bajaj Discover 100 CC and It’s giving me the average approx 60 in city and 65 to 70 on highway.
I used to go to my home town by my bike i am a software engineer and working in delhi and my home town is 280 KM from delhi usually in one tank full i can go and back from my home town. it means 10 L and 600 Km.
Can you please guide me how can i increase my bike mileage
Hi Dear,
I Have a Honda Unicorn. In starting my bike give a 50 up mileage but now my bike give only 35.so give me good suggestion for how can take more mileage.
my bike gets an average of………57 km/l…………i have a PULSAR 180…….best riding in city……this is the city average……
my bike gets an average of…… 45 – 50 km/l……i am having HeroHonda CBZ old model 1999.
wat i want to increase my mileage
Hi friends,
Here’s my issue related to my bike..
.
.
Model – Bajaj Pulsar 150cc (Digital) 2007
Owning Since – 4 Yrs
Average Max – 42
Average Min – 24
Current Average – 24 to 34 not more than that…
.
.
Because of this i got my bike repaired as per my mechanic recomedation..
1) Block Piston – Changed to New
2) Rocker – Changed to New
3) Timing Chain – Changed to New
4) Chidiya – Changed to New (Dunno exact name of that)
5) Wiring – Changed to New
6) Horn Switch – Changed to New
Cost Incurred – Rs. 8000.00
Inspite of this i am not getting average more than 30 Km. What should i do..I Really need a help
Regards
Monty
In
You have changed a lot..
just one more change..
change the BIKE.. ( to splendor) to get more milege..
Deepak, Is 45-50 (on an avg) a good mileage for a Hero Honda Hunk(2010) model which has completed only the first free service?????
hi , i have pulsar 220s , it is giving milege of 22 to 25 km/pl , how can i improve my pulsar milege ?
@akshay,, I am using a P220 Dtsi. I am able to manage it with a mileage of 44kmpl in city… on long trips its obviously low because I ride it really fast.
Change all gears at 4000 rpm. at 5th gear it touch 65kmph. check out the mileage with this type of riding. most importantly maintain correct tire pressure. front 28 and rear 32.
make sure your chain is properly lubricated with chain oil.
I make a fastest 65 and there I stop accelerating further.
Any ways after all this if u still experience a bad mileage let me know.
i have krizma zmr.
how to maintain milege?
My bike is bajaj boxer and it goes 90km per hour easily.but mileage is too bad only 35. what should i do to increase it.tell me
Reduce the speed
i have honda activa (black) 2004 model…. it gives a mileage of 30. does damage in rear wheel bearing causes mileage to drop…. please help me how can i increase its mileage….
Cool one…
just its Day 1 and got tonnes of info…
many thanks to all…
Will keep sharing the info from my end too…
So do watch out 4 that.
I Own a CB Unicorn black done with 4K kms.
yet to go for the 4th free service.
So far i didnt check out for any mileage… but i remember it pumped up to some 55kmpl initially..
But after reading the comments in the forum, thot of testing the mileage.
my bike is Suzuki feiro , the vehicle millage is very low,giving only 30 km pl, so plz give ur suggestion.
I have FZ 16 n gives milage only 28-30 kmpl…
how can i improve milage…
my bike is HONDA Stunner and i also happy with my bike and me and my frnds were going for long drive and enjoy ride my bike average is also good in 100 Rs it run about 95km and its top speed is 125km per h
Guys,
Good to see so many comments and suggestion. Keep up the good show.
I have Pulsar 150 old (2003 make) and it has done 70,000 kms. Still I am a firm believer that I have got a bike which can beat many new models as far as acceleration is concerned.
My only worry, bike runs 55-60 kms in Rs 100 (1.73) liters of petrol. And few days back it stalled as the spark plug gave up. Mechanic says to go for boring and all but I think still my bike has lot of metal.
Really want to avoid this torture.
Would be great if I can get some suggestions/tips as to whether I should go for it or not. Bike gives a black smoke at high rpm.
I own a bike which belongs to 150cc segment.
It is now 14500 kms done. With a mixed 50:50 ride on city and highway, I get a mileage of 58kmpl even now. I have never faced any service complaints yet. It exhibits above normal performance, above normal looks, above normal riding experience.
Can anyone guess what my bike is???
i have a dazzler150cc and it gives 55kmpl
I’m gritto, my dad’s bike is Passion Pro 2010 model. It gives only 35KMPH.
Bajaj Platina – 83 kmpl on highways/80 kmpl in city
I have apache 160. newly it was giving me 30 km/ l but after first servicing its giving me aroun 50 km/l. its awesome withm whoooommmm. sound!!!
I have Honda Shine bought on may 2009 since bought mu bike its giving average of 40 to 45 kmpl but the company is claiming avg of 60kmpl ..
Actually I ride my bike at the speed of 50 to 60 kmph
pls give some suggestions i am sick of my bike
I also own honda shine. 2010 model. CB Shine…
Believe it r not, im getting mileage of 80-85 with proper speeds..:-)
I have bought Yamaha FZ in Feb 2010. On an average it gives 40km/L.
Initially it use to give only 37
………….Now its lot improved.
The showroom mechanic say to ride it around 60-65 Km/L to get more mileage.
pls let me know your suggestions!!
Hi guys i have purchased tvs appache rtr160 red 23rd march 2011, its given 48 km/L to me, yesterday only i did my first service, but am not satisfied my service, they are not rectified my complaints, my bike have viser sound, slightly hand bar turned but they did only water service and oil changed. And for mileage i will check it and update guys,,,,, my ecpectation is 55 km/L. let check it.
I have bought Honda Unicornin Oct 2009. On an average it gives 45km/L.
The showroom mechanic say to ride it around 55 Km/L to get more mileage.
pls let me know your suggestions!!
Hi Guys,
I have splendor plus 3 years old, i am getting mileage 50-55 in city.
In highways 45-47 kmpl.. i used to go 70-85 speed in highways.
Will it be good?
or can I improve mileage in highways?
your words justify your question. Uday,if you consider your speeds in city as well as highways,the mileage drops considerably. for a 100cc mill,you are yielding 70-85kmph which are generally achieved by 1000cc and above cars. not only the mileage,your safety levels are dropping for every 10kmph speed you increase.
you believe me or not…my father drives 1999 model splendor at 45-50kmph speeds. the mileage we obtained is 70-78kmpl[depends on filling stations' fuel]
drive splendor at optimum speeds,that’s your machine your life. drive safe.
Yes raviteja.. u r right…thanks for ur suggestion…. i will maintain optimum speed..
@uday ….
yes slow down highways
I ride cb unicorn dazzler.
my avg speed 48kmph.[in rush roads also].
I acquire a mileage of 62kmpl. [avg].
hi this is anil i wanna buy a new bike for good mileage and stylish for my college long journey….. so friendzzzz plzz suggest me….. which bike is better….
new passion pro….is best …good bike…good mileage…good look. … good re-sale….
Overall good…….
Do do really have a passion pro? If yes you would not have told this..
Poor pick up and power ( don’t ever think of overtaking @ speeds of 40kmph)
very poor mileage ( if gives me only 40KMPL even on speeds 40Kmph-50Kmph)
but it gives me a very loud engine sound
ride it for 1 hr and your are gonna get a back ache
design of course is not much bad ( black one is good )
and at last the head lamp is still the old type which varies with the engine speed.. you wont see the road if you have to apply the clutch ( very useful on gutter roads with turns )
These tips are really good. I’m very much proud of this site. I have got one question. Above you mentioned that we need to hold the choke and self start the bike. We should do this every time I start or once in a day?
if ur byk is giving 30kmpl..then sell it 2 me i am gng 2 buy for 10000rs r u ready
Hi Friend…
My Name is S.Narsimha Swamy , I have Hero Honda Glamour 125CC. And I am very unhappy with it. It is gradually decreases it mileage from 52 and now it is 42,it has done 6,000+ KM from 7 months.
i drive my bike at a speed of 48-60 kmphin Highways,in city it is given 40KMPL,and i highways it is given 45KMPL.
So,please give any solution for increase the mileage of My Bike.
Thank u…
S.Narsimha Swamy
i have got pulsar 135 LS which is giving me 55 kmpl on city road of kolkata.my main funda is to keep the speed below 60 kmph and changing the engine oil in evry 2000 km.
hi..fnds i have own recently 2011 new cbz extreme with ATFT engine..my fnds r say it gives more milage how i can check milage????
I bought Honda CB Twister during 3rd week of March, 2011 and reading several reviews on bikeadvice. I have run about 1300 kms. I am following tips given on bikeadvice and beleive me my bike is giving me mileage of 70 kmpl in city conditions of New Delhi where there is too much traffic.
my bike unicorn dazzler4 gives me 55 in city and 60 in highway
hiiiiiiiiii frnddzz,
am new to this site, i own pulsar 150 dtsi, i got 35-38km/ltr, i ride bike rashly, and i used to fill petrol from an unauthorised petrol bunk( from a house) mostly. now i understood that my bike is givibg me sufficient mileage, my bike is not gonig up from 98km/hr, would anyone suggest tips to increase top speed?
pls………
pls……………..
would k&n filter will increase mileage? if yes , how much???(in pulsar 150 dtsi)
Hello All,
I am a new reader of this blog.
I have Kinetic Lazer GF 170, Its a sporty look bike, very few of us know this bike. I get 35-40 milage. the tips as mentioned above are really good to follow. I do so few of them.
I want to sell my bike since I am going out of India. Please let me know if any one is interested.
-Milind
9768929610.
i hav new HH Hunk ..purchase b4 a month..covered only 220kms..giving mileage of only 30km/ltr…will ti increase gradually after servicing…?
my p150 is giving 42 kmpl.. wat to do.

do proper gear shift and dont rev unnecessarily
.i don’t do rash driving either..
someone told me to clean the air filter, wud it b a noble idea?
i m planning to buy a second hand cbz extreme bike which is already run 18000 km, tell how to maintain a good milleage
hi i have 2010 pulsar 150 cc it giving milage of 48 in highway in city 42 and i have discover 100cc it giving 75 in city
hi i have baja boxer ct 100 , It is give me only 25 km per ltr petrol,how can i increase its performance?
I have Bajaj Pulsar 150cc & i am getting 45kmp/l average in hill ( Himachal Pradesh) ,
my question is that : can i get more average from my bike. pls suggest som tips for the same.
Rgds,
Jatin Dhiman.
I have a Pulsar 200, 2008 model. I use HP Power. My bike gives on an average 40-45 kmpl. It’s still in a very gud running condition. Love the bike….
i have a crux yamaha 106cc . it gives me 50 to 60 mileage but before somedays it gives 40 to 50 mileage then can you tell me what to do and its model 2003 and i want to purchage 160 apache or 150 pulsur so please suggest me which bike is better for me i want to good mileage
Very good advice. Will surely try.
i bought new CBZ xtreme with digital meter without kick start it gives mileage just 40kmpl
Hi, I bought honda CB twister last year, and it was giving good average around 65+.
But from last 2 months the mileage is getting decreased to 45.
I do smootth driving not exceed much than 50. ALso, I serviced the bike regularly.
Any idea or tips?
Hi,
I am using Karizma R bike. I bought 2010 spetember. Till now 3 services completed. My bike give 38 Km. / litre in bangalore city roads. If i go on highway my bike returns 47 km/litre. I just followed the tips mentioned in this post. Thank you
enjoy the ride.
hai iam having the discover 135 cc bike my bike is giving 34 in town and 39 in highway iwant to increase my milage so what i ahve to do pls give me advice
HI i m DHANRAJ RATHOD, From Hyderabad Andhra Pradesh, i own a HONDA UNICRON 150CC 5 mnths old…its givin a mileage of 38 kmpl..i dn ride very smooth and plz reply…n ya i want to kn how to improve the milage.
Thank you.
I have YAMAHA-RX-135,2003 make. my gives average mileage of 45 km/ltr in city and 47 to 49 in hoghway rides. this is bcos of proper maintenance.
i have purchase new HH hunk on 11 may i got 55+ average and i done my bike first service.awesome
hiii,
i have 2007 passion plus, it gives 40-45/lit,
i made regular servicing then also it happens,
i have daily 60 km running.
please suggest what to do.
I have Splendor (2002 model). It gives me 65 – 70 kmpl (on an average in city cum highway traffie)
hi i too have HH SPLENDOR 2001 model in city i get 65 and on highways i get 77 i dont want to sell this bike but i want to buy suzuki gs150r, can u pls suggest me something becoz i want a new bike 150cc an also economical bike i dont consider the looks… thank u.can u suggest me some bike…
I have TVS Jive 2010, it gives 70 KMPL/Lit,
hi i oqn a pulsar 135 m living in a small city and roads are crowded here so i cant ride well and not getting good mileage what should i do
hello guys, igot yamaha szr on 20 may 2011, in showroom thy said that i will get a mileage abt 60kmpl, bt wat m xperincing nw, dt m gettin nly abt 35-38kmpl, i went to the dealers n they said tht it will gradually increase from 1st service onwards, is this true?? can any1 help me here?
thanks.
dude u done a mistake yamaha are not fuel efficient bikes.. it will give u a better riding speed and engine has great power . but mileage is not to be mentioned for the yamaha users.. i sawn many of the yamaha bikes of my frens they are not mileage efficient bikes its a big hole to our pocket to maintain yamaha bikes in 150cc range.. my frens yamaha fz gives only 35kmpl max mileage.. i think u have to wait for servicing and then check .. best of luck
dude u done a mistake yamaha are not fuel efficient bikes.. it will give u a better riding speed and engine has great power . but mileage is not to be mentioned for the yamaha users.. i sawn many of the yamaha bikes of my frens they are not mileage efficient bikes its a big hole to our pocket to maintain yamaha bikes in 150cc range.. my frens yamaha fz gives only 35kmpl max mileage.. i think u have to wait for servicing and then check .. .. but if u drives the bike at rpm below 4000 in any gear u will get the max mileage that the bike can deliver to u .. try this once best of luck
I have Honda Unicorn(jan 2010). It is giving me 62km/l.
fz16
millege 28
how can i increase millage pl z help me friend
maintain rpm below 4000 in any gear and dont race higher speeds in the basic gears..
Hi
I have pulsor 150 cc model 2003, which i purchased second hand last year Jan. It used to give me the average of 40 km. But 2 two week ago i got it serviced, and now it is giving the average of 20-25 km. I am surprised, please help me whats wrong and how can i improve my mileage.
I drive my bike in Delhi city.
hiii i have purchased cbf stunner which gives 45 to 50 km is it correct average
i servece is going to be soon
i have new cbf stunner which has self without kick model, which gives me a milage of 38-40 kms ……i dont know how to increase the mileage please can u tell me some tips to increase mileage…
Hey i have a pulsar 150CC bike of 2005 model. its giving mileage of just 40 KMPL. Can you please give me some tips to increase the mileage atleast to 55.
I have herohonda cd deluxe, it gives 72 – 75 KMPL/Lit,in city i have not tested in highways
Reply
hai
i have bajaj xcd 135. its 38 mileage in the city. i am not satisfied with this. so plz tell me the good solution for getting mileage between 50 to 55 in the city.
Hey dude i have pulsar 150cc of 2005 model which runned almost 35000 km’s n its giving mileage of 45KMPL. Please please do suggest me how to get mileage of 60 n ABOVE. that is enough for me. Because i daily travel around 80 km’s to go to my office n college n i’m spending around 150 bucks just for petrol. At the end of the month i’m spending almost 4000 rs just for petrol. I can’t bare this anymore. So pls do suggest me soon as possible on my mail(srinathreddy0533@gmail.com).
hi,
This is khadar i used to travel daily 20 kms up and down please suggest a bike to me gave maximum mileage i dont know about bikes
Dear All,
I have Honda Unicorn Dazzler(150cc), which completed 1 year on 20th june.
My bike is giving the mileage above 45kmpl but below 50kmpl.
is it fine?
or there is something wrong with my bike.
Also I have changed the starter relay of my bike. is it normal that starter relay malfunctions so early?
Also i have changed the break pads of rear disk brakes as thay got scrubbed all…..is it normal?
Please guide me for the performance increasing strategies…..
Waiting for ur precious guidelines…
Thanks a lot….:)
Hi All,
One more thing which i forgot to ask…
Is it possible to have kick for my bike?
as it is provided by Honda……
Hi,
Can one please suggest, how to use Clutch effectively to get good mileage for the bike ?
Also, can you please let us know do we keep clutch when the road is down.
Thanks
Can anyone please respond to my post. How the Clutch will effect the mileage and how to use it properly to get good mileage when the road is down ??
Dear Friends,
My new Splendor PRO is giving Milage of 72-74 kM in outdoor and 68-70 in indoor. I am going in my speed of 40 KMPH to 49 KMPH
I want to strengthen the same for the future years. What can I do ?
i liked the comments. I have a Yamaha FZS and i really struggle to get the bike past 75kmp/h. any tips? i also have a K&N filter installed but does not seem to be of much effect. i did not change the carburetor jets though.
hi iam having pulsar 200 cc and its giving 38 to 40 milage…plz help me how to increse the milage plzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz
Hi everyone..
I own a bike 2003 model bajaj caliber 115 (hoodibaba).
it used to give average of nearly 60KMPL.
but i didnt used my bike for four years coz i was out of state now i started using it and checked the average and shocked.Now it is giving me 24 KMPL.
I dont knw wat to do???
Pls give me some tips
I have a new pulsar 180cc ug4. Rode 1600kms till today, my bike gave 40 before first service when i used to ride bellow 50, now i am getting 35-40 when i am riding 60-110.
Please instruct me getting good mileage without decreasing the speed of the bike?
45-50 would be GREAT!!!!
Can i get it???????
do no modifications only use genuine parts and do bike servicing at regular intervals
I have Hero Honda Glamour carburetor version (2009.) at starting my bike gave mileage of about 50 kmpl. but later it reduced to 40 to 45 kmpl. at present it further reduced to around 37 to 40 kmpl.. can u plz help me to improve my mileage?
hi get happy jounrney
Hi ,
i am using Discover 125cc 2004 Model it gives only 45 in city and i am driving it on normal speed 40-45 KMPH.
Plz share how to improve the Mileage.
Dera Mr.Sir/Madam
i want to know how to increase my Avrage of My 180cc pulsar Bike
my bullet std 350 cc give me very low millage 20 to 25 only
First of fall min. use of clutch and do not fill the tank fully because they increase the pr. between the atm. and the throt of the venturi of the venturi causes increase the fuel delivery rate and the last one when you start the bike for few sec you leave it without open the throtle.
I have yamaha fz 16… Model 2009 and i get 45 in city and 48 on highway
hello
i have bj pulsar 150cc 2009 model. my bike give around 35km/ltr. what else i should do to get better mileage.
my pulsar 180 ug3 give me 40km/litre in city n 45 on highway
i drive honda unicorn,
and it giv me the avg of 40 km/lit
is it good or it can b increased…
one more thing i just dont care about it it is like it is just working wth 0 maintanance
My FZ-S completed 4 months today and the mileage, which i measure fortnightly, since 1st service has been 50, 40, 45, 41, 39 kmpl consecutively.
All the riding till now has been in city only.
I have Stunner PGM-FI. I use synthetic oil – Motul 15W-50. petrol mostly Shell only. In city i get 56 and on high way i get 63Kmpl.
Bike : Passion Pro
Model : 2009
Mileage on Highway :60 KM. to 65 KM.
i have honda shine 125cc with milage 52/ltr.
hi.. i have a new honda cb unicorn dazzler… it just completed its first servicing but the mileage is only 35km/ltr… this thing doesn’t works out so plz sujest me some ways to increase the mileage… and even sometimes it starts to make noise as it is on the 5th gear and seems as if it is on nutral and we are accelerating it…
I purchased a splendor+ three Years ago. Now,I am getting 30KMPL-35KMPL mileage in City and same as on Highway. Yesterday, my journey began from Ahmednagar to pune (125KM approx) my splendour+ given me the average of 30 KM-PL. 1Yr back same average Provide me, when i traveled the same distance. When I clean the air filter, engine oil as well as carburetor, But still not able to improve my Bike mileage up to 60KMPL. When I Follow the following steps to improve the mileage, then after my bike provide me the average of 40 KM PL. How it is possible to reach 60KMPL. My Friends told me that u r lying, splendour+ have the ability of mileage up to 70KMPL. Please please help me. I hope u reply me as soon as earlier. because again i want to clean the air filter, engine oil as well as carburetor to reach 40 KMPL. Thanks and Bye.
i am having a tvs scooty es.
model: 2002
i have bought it second hand from dealer last sunday.
the dealer said that it give mileage of 50 around.
but i thought it gives less.
how can i increase my mileage.
at what speed should i drive,
max speed: 80
2t mix petrol is recommended, but when i go to petrol pump, they give normal + oil pouch of 40ml.
in ratio normal(1 liter)
is the mixing correct.
could this be reason for low mileage.
please recommend suitable help
my bajaj 220 dtsfi gives mileage of 48kmpl in traffic
Hi All
I own pulsar 135, it gave me a good mileage of 65kmpl before my first service. I have driven more than 19000 kms now. But it gives me only 55-58 kmpl. Is this Strange or is it normal.. Any suggestions to improve mileage ?? pls suggest me..
Thanks..
Namaste,
Happy Independence Day wishes to all of you.
I owned a HH Splendour for 15 years. I want to sell it off & buy a new bike.
Prsnt situation: I am 43 yrs old, 1 wife & 2 dtrs, not much of travel [just about 20 kms daily]
that too, only to drop kids and pick them up fm school.
I have shortlisted 8 bikes:
TVS Star Sport, TVS Star City, Suzuki Slingshot, Honda Shine, Honda Twister, Bajaj Platina 100 ES, Bajaj Discover 125 DTSi and Bajaj Discover 100 DTSi
Pls tell me which is the best bike for me? My criteria is:
Good Mileage [petrol is Rs. 75!]
Good pickup [Bengaluru traffic is the worst in the country!]
Good brakes [I am told that disc brakes are better than drum, correct?]
Good speed [may go out of city sometimes]
Good looks [chaalis hua tho kya hua, impress karna padtha hai]
Good after-sales service and
Good price
Thanks
V S Gupta
Hello every1,
My name is Kallim n i am from kalyan mumbai.
I hve 3bikes 1st one is pulsar 150 cc which is of 2006 model till current it gives me abt 51kmpl.n then ii hve fzs which gves me 45kmpl n den my lovely street bob.. royal enfiel 350 which i bought in January 1st 2011 it gives 43kmpl…all my bikes aree time to time maintaind properly…
i have tvs apache rtr 180 its milage 43 in city..
I have TVS Jive. It is delivering a milage of 52 to 54 km only. Can u help me.
i have honda activa new model 110cc, at 29th august going to Goa from mumbai 600kms. so what do u think guys activa could make it.
i have honda cb twister now its gives 60 mileage i want to improve that mileage pls give me the suggestion
i am having 2 pulsar 150 c c 2003 with me one is giving 55kmpl and other is giving 40 kmpl ..i think milage is depend on the carburater adjustments thats all. Its depend on driving also but but even we drive rashely 15km defference is some thing undigestable …..this all tips wont work out if good milage is not in our fate
I bought a unicorn before 1 year
stil it gives me a mileage of 58 on city and 64 on highway
Hi friends,
i am planning to buy a bike.can u suggest me which one is better from Splendor pro and passion pro.or any good one suggets me.
maintain rpm below 4000 for better mileage in any gear this is the fuel manthra
I own a 220 cc pulsar vehicle ……… it gives 50 in the city and 55-60 on highway’s !
Hi,
I have purchased new Honda Unicorn Dazzlar on Apr11, it is giving good milage 55 KM/ltrs on Shell normal petrol, 50 km per other petrol like Bharat petrolium. I am very much happy with the performance….pls advise riding tips and improve milage etc….
sir my father use hero honda plesure new model 2011 3 servicing r complete but it gives very less mileage so wat i do for good mileage.
Hi all of you,
i have the hero honda passion pro,its only 2 year old,
i had done the services from service center only.
but it is giveing only average less then 42.
please give me suggesation, beacause i can not affort this.
also want to know, from which pertrol pump is better for bike mileage & life
Hi,
fyi i have purchased tvs apache rtr 160 which is 2 years 8months old,but i hav driven the bike only 20,000kms and now m faceing poor mileage of 25km/ltr due to economic hike of retails.it is difficult to maintain my fuel cost….
so pls kindly suggest me to maintain the mileage problem…pls
thanks & regards,
dinesh kumar
i have tvs apache rtr 160rd i completed 450kms n i am getting mileage of around 60 in heavy city traffic of hyderabad n i have yet to ride it on highways.
I have 2007 model Bajaj Discover 125 CC. I drove it for 47000 KM. I used to get atleast 60 KMPL initially. But lately for past one year I’m getting just 50 – 52 KMPL. I drive in non dust conditions and there are no traffic signal in my drive to office. I don’t understand why? I also maintain strict servicing schedule. I get it serviced every 2500 KM. I did not change Air Filter untill now. And I never check the Spark plug mm. Do these two effect the mileage?
How gud is Honda CB Twister ??
will it giv a mileage of 55-60kmpl/above in chennai city traffic conditions ?
Twister is great bike for those who wants Style + mileage,my dad has the same bike and it gives 72-75Kmpl in Kolkata,so it will surely do the same job for ur city,the bike is powerful enough to be a 110cc commuter,when Hero Glamor has 9bhp power then as 110cc bike Twister has 9bhp power, even tubeless tyres,so go for it, “Yes HONDA” bcz I enjoy the Quality!
i got a thunderbird twinspark its giving me 40+ in city
oh and my bike is 350cc
Hey frnd, i have hero Honda Passion pro. It gives me hardly 55 km/Ltrs. I want to increase the mileage of it. Please suggest.
Hi frnds !!
I have bullet, giving me mileage of 35-40 kmpl.
Gud na !!
2008 Karizma-R (ZMA) 33-35kmpl & 2010 TBTS 36-40kmpl in Kolkata stop n go traffic.
Hi Dude,
I have Pulsar 150 cc Model 2003 its giving 35 kmpl so wat should i do to increase mileage
Regards,
Basavaraj
hii frnds !!!
i have hero honda cd100ss.
avg speed: 50-60 km/hr
avg distance daily: 100km
mileage: 70-75 kmpl on city & highway.
i am very happy with this mileage…
can other bikes of latest model beat this mileage?????
i have brougt a new cbz-xtreme giving mileage 55 it will continue for long time or not.
maintain the bike properly then it will give 50 to 55kms, SPEED LIMIT OF 45-50KM/HR
Hi frnds !!
I Have Hero Honda Hunk, giving me mileage of 35-40 kmpl.
So Gud Or Bad.
My friends Hunk is also getting 40kmpl. For CBZ its 40-45kmpl so i think its normal.
I own RE Thunderbird and mileage what i get is 38kmpl with city and highway ride.
I own Herohonda passion plus 2004 model and ran over 84000 kms up to date…i m constantly getting mileage fm 60km – 65km…Its in good condition..But now i want to change to a other new bike..plz suggest me…The vehicle is purely for single use by me…
Hi Deepak,
I have bought TVS Jive around 10months back
Initially i got around 60 kmpl (I am not in city,I am in outer side only). But now my milege is only 42kmpl. I am worrying more a lot for investing in this.Moreover when i am accelerating the pick up is somewhat less in my bike.Can you advice what to do to improve milege?
Thanks
Muthu
Hi, I am having pulsar 180 Jan 2010 model, my bike has run almost 30,000 KM & it is giving avg between 40-45. I m preety satisfied with it.
My Stunner CBF 125 CC is giving me average 65 kmpl.Is anybody’s stunner gives this?
I have YAMAHA SZ-X.. bought Last month.. My Mileage is 36KMPL
Any yamaha specific tips??? Please help.
Hi my self Madan, i have a CBZ xtreme, & its gives me around 58km/pl. I think its a very mileage for a heavy bike like this
Please suggest me how could i can make my bike health and good performance.i am having plusar 180cc.
I have an passion plus and it gives mileage of 60 kmpl
hi
in chennai which bike is giving best mileage pls mail me
thanks and regards
S.Bala
I am having YAMAHA FAZER 125 cc 2005 NOVEMBER it gives me mileage of 65-67 in cities 72-75 on Highways but o have to change my chain and spokes frequently. Since two years i have changed them thrice can you suggest the way to avoid chain and spokes damage sudarsan ji
i hav a p180 last 2009……and gives 40/42 average
at last
i think i am the only
owner of bajaj platina 125 .so i am telling you my experienced gain by it,its a nice bike especially from its mileage,and if you are a cool minded man and your thinking is not a materialistic then i think its the best bike,but i again write here if you are not matrialistic…………………baki aap bta do yaaaaaaaaaaaaaaaaaaaaaaaaar
sunil thakur
partap nagar,professor colony amb distt una himachal pradesh
i hav a yamaha fz wic is 2 years old and i was getting 38-40 kmpl, but from past 3-4 months its reduced to 28kmpl…can anybody suggest some tips to improve it…coz every aspect of fz is awsome except for milage….i hav heard fz’s give around 40kmpl…but not mine eventhough i get it serviced periodically…
anybody HELP me out
New hero honda glamour 125cc kinlam. dhaka’r rastay koto mileage pabo? karo experience ache ai bike er bepare? kisu tips den, for mileage, performance and safety…. thanks in advance.
Hello,
I need a favor from you. I have a bike Hero Honda 100 CC, modal 2010. Its mileage is very very less, dont know why?
Condition of bike-
-10,000 km in 2 years.
-Servicing at on right time. Changing its oil always with castrol 4s.
-Runs at 40-50 km/hour.
-But Mileage is 30-35 km/liter.
Pls help and reply me as soon you can.
Thanks.
Dear all,
My SUZUKI GS150 R is giving 46km in city ride. Poor pick up, surely not suitable for hill station people. sucking hard for pick up even in flat roads…
Having RX 100 YAMAHA runs more then 1,50,000 Kms. getting engine opened after 12 yrs. getting still avg. mileage of 50 Kms./Ltr. Its an unbeatable bike, its evergreen, comfortable, and also maintenance free bike, Its unbeatable, unbeatable, un……………………… discrepancy only is 2 stroke engine.
Hi Deepak Iam regular reader of your Bike Reiveiws and it is very usefull and very knowledgefull to all of those who are riding bikes. I own Bajaj Pulsar 150cc and my gives 55-58 in city roads I use to go on 50 to 55 speed.
Regards
Mohan Krishna
Hiiiiiii
i had bajaj Discover 135-DTS i get mostly average upto 65Kmpl even i had added knan filter to my bike.
Dear Deepak Raj
I m having bajaj platina 100 cc 2008 after three and half year it gives me average of 90 kmpl(43000 kms done) i m very strictly follow the ruels which are maintioned in bike advice site under title of how to improve bike’s mileage. i m very happy with my bike’s performance.
Regards
Prashant Pawar
Surat.
hello everyone, i recently purchased a new model of cbz exteme, i want some tips for my bike about everything like how should i ride my as it is new, how should i take care of engine, its part, how should i get more mileage. Plz help me. Your tips will be very helpful for me.
My email address is chetanchouhan88@gmail.com send me mail if u think ur advice is very helpful.
Thanks!
I’m from bangalore and I start early in the morning…. when it will be very cold.. How about warming up the engine…. Will I be required to run it for about a minute simply idle to warm it up ? I’ll be getting a platina in another week.. ‘Ve booked it already.. waiting for receiving it….
Hey gus i have apache rtr 160 cc hyper edge black color bike it’s wonder,it’s giving 65 milage on highway raide and city itself its giving 55 kmpl,nice pick up and breaking system i am not my bike for raide another person.if u want milage u just drive first 3000 km up and down with speed 45 km per hour,50 and 55.if u do like this u will get that millage .
Yeah …I do agree Murali’s comment.
Here I have a Unicorn 150CC 2010 model. My bike is giving 65 KMPL when you ride the bike with the speed of 40 to 45 kmpl. But Surpricingly when you ride in Highways, I get 40 to 50 kmpl due to going over speed with 70 to 90.
As Murali said, just ride ur bike with the speed of 40 to 45 kmpl, sure you will acheive good mileage as day to day petrol price is going up..:)
My dio gives mileage of about 40kms/ltr…so how to i increase my mileage.Will putting a air filter will increase my mileage?? frnds do rpl n share ur tips to increase my mileage.
hi friends.,
could you pls advise me a bike that gives best mileage , on daily usage of 60 km’s ,
Any model,company, either with or without gear, etc……. should be great with mileage.
my pulsar 180 was giving 49-52 before 1month but now it decreed to 45
Hi,
I own a Apache RTR 180. The mileage i am getting now is 45. Please let me know if this a good mileage..if not hw could i get more mileage.
haii…i ownz a karizma r just 800 kms done but iam getting nly 30kmpl..and i ride mostly in betwn 50to60..so what should i do to increase milage…..all r getng nearly 40kmpl for this same bike..
Hi
dear all i own pulsur 180cc bike, to be frank with you all, its realy a dump bike, where we cannot expect any mileage in that bike and more over my bike mileage is 20km/ltr, where in the showroom people said i would get 40 to 50 km/ltr, be safe with bajaj company.
I have Royal Enfield bullet-350(1965 model).It gives the mileage of 40KM/liter in city and 49KM/liter in long drive.
my CBZ xtreme, 2011 model is giving me 57km/pl in city, and I’m sure it will give above 62 in highways.
Drop in millage may have several causes.
1.Riding Habit – In the sense how often you use clutch and brake. I’m still getting 60KMPL for my passion 2002. I never touch clutch except for stopping and gear changing and apply brake to slow down gradually instead of sudden stop. Maintain speed in range of 45-50 kmph.
2.Engine Oil : Use 10w-30 or 15w-30 grade oil. Heavier the grade, more the engine strain to operate.
3.Spark Plug : Change your spark plug once in a year. Also remove the spark plug and check the colour of the tip, if its grey or black ask the mechanic to adjust your carb. It should be in copper colour.
4.Carb : Clean your carb once in every 3 months. This can be done in any mechanic shop.
5.Tyre Pressure : 25 psi on front and 35 psi on back is ideal. but to get extra millage you can keep 30 psi on front and 40psi on Back. But be careful in driving as you might feel less control.
apart from these there are many other factors…
hello
my bike is pulsar(old model 150 cc)
its giving milege about 40 in city ..highway abt 45 …i want to increase my bike milege can u give me some tips..!!to increase my bike mileage
dude.. iam also the owner of pulsar 150cc new model .. once read the pulsar manual to get fuel efficiency dont go for high speeds in 1st and second gear and always make a habit to maintain the rpm below 4000 i mean 4- in display .. in any gear 1st or 2nd or 3rd or 4th or 5th in any gear maintain the rpm at below 4000 then the petrol combustion is minimum and the bike will surely give the better and better mileage as it can.. i got 65kmpl by this rpm trick.. dont forget to start ur viechle at the begining of day with kick rod on everyday . and for example in 3rd gear below 30kmph its rpm is below 4000 and in 4th it is 40kmph and in 5th is 50kmph speed with this speeds respectively to the gears .. u will get a maximum better mileage as can that the bike can deliver to u.. hope u this works.. pulsar rockzz..
I perefer to check brake friction and tyre pressure and spark plug i top up my bike oil with additional 50 to 100ml.. eventhough i dnt have any problem i ask mechanic to open the engine and clutch and i find that clutch plates have 7months of life if you rides daily with regular oil change clutch plate wear is so slow that you cnt notice the lowering performance.. same is with the valves and timing chain..its better to overhaul clutch,timing chain and valves once in 15 months.. and change it if required.. same happens with piston rings no one would never notice the diffrence.. but every one feels the diffrence when you overhaul it.. it goes faster.. it sounds smoother it response so well and if you ride it with average speed you ill get good average too..
more over this riding style does matter i own a Baja Discover when ever try to tackle timing of train or rides hard at 80-85kmph i hardly get 25kmpl average.. However same bike gives me 48kmpl at the speed of 50-60kmph.. and in a time of emergency i did 12kms with 100ml Fuel at the speed of 25 at 4th gear without breaking….
Hero Honda splendor 2002
Hero Honda – Super Splendor – In city – Average 72 kmpl.
I have a suzuki samrurai model-1994. It gives me average og 40 in city
hi
i hv purchased honda stunner 2011december model,but it gives me the average of 31kmpl……what should i do for this..please suggest me……….
Dude then go to honda service center,I know Honda is best,but in case of ur bike there are some problems.
I have purchase new bike splendor nxg in dec 11
it give only 35 km/pl
pls tell me what to do
I have Honda CBF Stunner and now 3year old but I still love my sexy bike,well when first I get this bike then the mileage was 60Kmpl,but now it is like 53-55Kmpl,never goes over it,but most of the time I ride my bike in city roads,like jams etc. even after doing pay service it is giving 53-55Kmpl,even I change bike engine oil in every 2.5-3months,now advise me how to increase my HONDA Stunner mileage,thank u all.
because in service center they tested without load ( man load ) . but in road there are more resistance like Tyre friction,air,load.
babu splendour go check with bi cycle it is better 4 u .
Hai guys recently I bought a new cbz x-treme 2011 model bike it is giving good mileage of 50kmpl in the city, everything is fine but it is getting vibration after reaching of 45km’s speed . so please tell me some tips to make my bike vibration free…..
my bike is pulsar 150cc 2011 model ,i totaly spent 1500 cost of petrol still my bike is in reserve free. and given 1131 kms and still 3.2 ltr reserve fuel in tank.. so as per total caluculations i got approxmately 65kmp/ltr mileage.. i alway choose to ride my bike with rpm below 4000 in any gear and in highways max speed of 60-62kmph and min of 35-40 kmph. so guys ,mileage depends on handling doesnt mean to viechle
if we use it in optimum conditions it works maximum.. dont race more than 4000rpm in any gear ur pulsar will give 65kmph.. its proven do it once… have a economical riding.. enjoy and save ur money .. and have a healthy driving wish u all best of luck guys
{ 2 trackbacks }