Tips for Improving Your Bike’s Mileage

October 31, 2008 in Bike Advice

The mileage of a bike is a critical factor in the buying decision and also keeping our running costs low. Many of you think that mileage is just about the cost of fuel, but it is not. A bike which gives a good mileage compared to other similar bikes is a sure indication that the health of the bike is well maintained and the rider is careful enough to get the bike frequently serviced and tuned.

I talked with Sudarshan from Chennai and was surprised to know that his Hero Honda Karizma R gives a mileage of 41 in the city and 49 in highways. His bike is in perfect health. To keep the engine healthy all you have to do is, let the engine warm up before you take it to real performance. Small engines like that of Splendor NXG and Passion Plus have a horizontal engine, so as soon as the bike is started, the oil flows easily into the engine. But bikes with a high bore and stroke find it difficult to circulate the oil throughout the engine as soon as it is started.

Sudarshan recommends bikers to put the choke, self start the engine and leave it for 10-15 seconds so that the oil gets heated up and the luke warn low density oil finds it easy to circulate through upto the top of the engine. Do not leave the choke for too long as it would flood the engine with fuel. Do not open the throttle until it has run for atleast 5 km distance and the engine comes to a normal operating heat range.

If you gun the engine in cold conditions as soon as you start it, there would not be enough lubrication in the engine and it leads to more friction which ultimately damages the piston and the engine and hence your mileage will be low.

If you go to a gym, your coach will ask you to warm up before you do some heavy lifting and iron pumping… this is just like that. Your bike is not much different from your body!

Another good tip worth mentioning is to remove the saree guard if there is no use for it. I am a student and even after I get married I do not expect my wife to sit on the high back seat of Karizma… I would be probably getting a free car as a gift at that time . So I removed the saree guard as soon as I bought it. It reduces dead weight by 4-5 kg and would definitely improve the performance of the engine and increase fuel efficiency.

Some basic fuel efficiency tips that you may have already known are 1. Switch off your engine during signals with long waiting periods. 2. Change your oil according to your manufacturer’s recommendations. 3. Check your tube’s pressure every month… higher pressure than the recommended value would give you more mileage but less friction and stability. So keep it to the optimum value.

I am interested to know what kind of mileage your bike gives. Post your bike model and mileage in the comment below and let us see who reports the highest mileage!

TrackBack URI

291 comments

Sangram on October 31, 2008 at 8:40 am

i have a karizma it gives me a mileage of 42 in the city have not checked it on the highway but the speed at which i generally drive i dont think its gonna be a lot.
Sangram on October 31, 2008 at 8:41 am

and i agree wid this cos i do the same thing before i start my bike.
Anil Yohannan on October 31, 2008 at 9:11 am

Hello Deepak,

First off Happy Dipawali & A Prosperous New Year To You..
I am quite interested in keeping myself updated in the Motor world; so I got your RSS hooked up on my email resulting in receipt of your latest reviews and tips regularly. I would like to share my comments on the bike I own :

Make : Bajaj Pulsar 150cc
Model : Nov-2002
Luckily my bike is in very good condition and it gives me mileage of 55-58 Kms in city and 60-65 Kms. on Highway; which I know is very good for a bike with 150cc.(Please correct me if ‘Am wrong.)
Deepak on October 31, 2008 at 9:22 am

Hi Anil, thanks for keeping up with my RSS email subscription. You have got great figures with the bike, keep it up. I have posted your question in the forum and answered it there.

Let this post be reserved for the mileage.
Shirish on November 1, 2008 at 10:51 am

Hii i am regular reader of ur articles. i have subscribed RSS to my mail ID. they are very useful esp the bike reviews.
I own TVS Victor GLS model. some 5 years old.
it has done 33,000+ KM and gives me 55/58 KMPL. i guess this its less. my driving is normal, but when i get late then i drive roughly so that causes more petrol.
thank you
Nishant on November 2, 2008 at 7:48 am

hi….i m ur regular reader and i enjoy ur articles…..and i m very thankful to u….. after reading ur this article as i m driving as per ur recommendations…..i drive bajaj pulsar 180cc and it gave a milage of near 43km/litre…….and i m very thankful to u….keep posting me ur tips for maintainance of pulsar 180cc
Harsha on November 3, 2008 at 4:18 am

I have Karizma. And I am very happy with it. It is gradually increasing it mileage. It started from 33 and now it is 37. When I used to fill up the entire tank and check it used to give me 34 but I am checking it fuel worth of Rs.500 it is giving me 37. Is it any factor i mean the amountof pertol in the bike. And also thanks I seriosuly appreciate the tips heer and also will appreciate more.
A Tip To Increase Your Bike's Mileage - Team-BHP on November 3, 2008 at 6:55 am

[...] lift from : Bike Mileage Tips… Increase Mileage of Your bike | BikeAdvice.in __________________ Hold fast to dreams, for if dreams dry, life is a broken-winged bird that [...]
shreekanth on November 3, 2008 at 12:24 pm

hey thanx 4 the tips…i own a bajaj discover 135 dts-i…….it gives me a mileage of around 55-58kmpl in city and 65-70kmpl in highway……..actually i ride the bike at 50-60kmoh thats it….
Hasan Mahmud on November 3, 2008 at 4:46 pm

I have a Honda unicorn150cc it gives me 28 in the city and 35 on the highway.how can i take more mileage now?
Lokesh on November 3, 2008 at 6:17 pm

Hi Deepak,
I am a new subscriber, i found it very interesting and whish to know more , bcoz. my bike knowledge and experiance is only of few months.

i bought a Pulsar150 DTS-I on march of this year and i am very unhappy with the performance of my bike. Its mileage is around 45-48. I have taken the atmost care, i have got all the services done well before the mentined time fearing of the drop in mileage.

Following are my regular riding practices;
* I start early to office, around 5:30am, I kick- start and throttle moderately until its ready to move.
* Ride at max. 10kmph in 1st gear, 15kmph in second, upto 25kmph in 3rd, upto 36kmph in 4th and above in 5th.
* Go consistently around 46-50kmph.
* Have reached 85speed only once for few minutes. completed 7500kms with 4th service done

I feel rigid in shifting the gear although i lift with my foot (instead of pressing with the heal), the engine also gives a weared sound and maneauring is not that comfort.

sorry for making you bored by long list of faults in my bike.Its my first bike and i love it a lot, but i found the bike dealers useless in guiding me.

“I will be happy if Anil and yourself would help in getting my bike to proper working.”
virendra on November 5, 2008 at 3:44 am

Hi recently i subscribed to bike advice really finding it interesting n useful i’m having suzuki 150 fiero of 2001 model mileage is only 35km, lots of electrical problems,engine noise,n also not serviced 4 since past 3 mnth kindly suggest good mechanic between andheri 2 malad tvs service centre is proving 2 b vvvvvery expensive.
thnx
Bezil Shrestha (Nepal) on November 8, 2008 at 3:50 am

Hi i have a 2005 model of Hero Honda Super Splendor
It has clocked 30K km till now, before my first service riding at 40-50 km my bike gave me 69kmpl mileage with mixed city and highway.
Now it returns just 50-52 km in city’s don’t know about highway. I am slightly on the speedy side of riding habits so i am satisfied with it, but i think my bike mileage is poor in highway. Is that an issue?
kamal on November 8, 2008 at 5:59 pm

i’ve bought by apache rtr fi this diwali.. i dono watz d exact mileage of this beast.. but i guess itz giving around 42 kmpl.. wat should i do to get good mileage.. can u tell some advice in gear shifting.!
ashish.s.choudhary on November 9, 2008 at 9:06 am

hiii…!!!
model:passion plus(2005)
i have a milege problem my bike gives the milage of 25 to 30….which i think is very low so can u jst assist mehow can i increase milage…!!!
thankssss..!!!
Niesh on November 9, 2008 at 2:32 pm

Hi
Deepak i am new to this site but after reading all the post.
i just wanted to ask you that i am planning to to take a bike little bit confused with some of my options are…:-
1) RZ-16
2) Avenger
3) Pulsar 150 DTSI

what do you think which is good in performance and maintenance as of now i ve TVS victor which gives a mileage of 55-58 Km.
heard RZ-16 is doing gud not sure of he mileage
My requirement is a good loking bike , which gives a mileage of 40 or above , and reuire less maintenance…….
Can you help me out….
sudarshan on November 10, 2008 at 12:50 pm

hi harsha
iam also a karizma owner.when you fill petrol dont fill more than 15 litres in your karizma’s petrol tank.the karizma has a fuel tank capacity of 17.5 litres but the company specifies to fill only upto 15 litres.

also use only normal unleaded fuel for the karizma no power or xtra premium or speed brands of petrol. make sure you fill from a company operated petrol bunk as the quality,purity and quantity will be optimal.

yes you are right as the more petrol you fill the more the pressure and it might increase fuel consumption but this is not properly proven so it may not be the case of difference in average of your bike. there could be other factors that are influencing the average of your bike.

the karizma gives 40 in city and 50 on highway but we must understand that such figures are dependent on fuel quality and quantity, bike’s health and condition, load and road conditions, traffic, tire pressure and a host of other factors as well.

do you get your bike serviced properly from an authorized hh workshop. the company only gives rough guidelines of getting the bike serviced every 2 months. this schedule wont apply if the bike is used more in terms of running or in dusty conditions. the bike’s engine oil and additive oil called ezi oil need to be changed according to the usage.

the company specifies to topup oil every 2000 kms and change oil every 6000 kms but the usage will depend on the frequency of your bike’s oil change and additive changes.

so think and try to find out what could be the problem in your bike. my bike gives me 41 in city and 49 on highways.

i change the engine oil every 2000 kms and add the additive ezi oil every 2000 kms. i do proper warming up by idling the bike for 5 minutes each and every time i kick start it i dont give any throttle at all. i employ the choke for a 10-15 seconds and after which i let the bike idle on its own without giving any throttle and revving up. my bike is serviced at chirag auto where there is a karizma specialist and he is the only person who i trust my bike for servicing and no other mechanic or service center.

so use and maintain your bike properly and it will serve you superbly and also give great fuel efficiency.

find out all the things which might affect your bike and if still the mileage doesnt increase post a message in this section and i will try and find out a solution for you.
sudarshan on November 10, 2008 at 1:27 pm

hi lokesh
if you want to find out more about bike tech stuff why dont you call me and i may be able to help you out as i cant post everything on the site and certain problems need a personal touch.

1. the problem i see in your method is giving throttle to your engine when your bike is cold at 5.30 in the morning. you see the pulsar has a vertical mount engine and the engine oil takes some time to heat and properly circulate through out the engine.

what you should do is before you start your bike put the petrol to on or reserve position according to quantity of fuel in your bike. put on the choke and keep it open, now open the throttle many times so that petrol enters the engine, close the choke and again open the choke and keep it on and again open the throttle a couple of times. now kick start the bike and leave the bike on with the choke for 15-20 seconds. dont give throttle once the bike is started. close the choke after 15-20 seconds and let the bike idle for 5-10 mintutes but atleast 5 minutes minimum is must with out giving any throttle at all. after the warming up drive the bike slowly and dont gun the engine by giving excess throttle for the first 5-6 kms. after the bike has run for 5-6 kms the engine would have heated up and the engine oil heated up to the proper circulating heat range.

2. it seems that you are changing the gears before hand and this is hampering the bikes pickup and loss of performance. every bike has a proper sequence for gear shifting and this has to be followed.

you must try and understand that a bike must not be over revved in lower gear or go below a certain speed on a higher gear as both will damage the engine and result in loss of performance.

i suggest you drive in 1st upto 10, 2nd from 10 upto 20, 3rd from 20 upto 30-35 km/hr and shift to 4th at 30-35 upto 40-45 and 5th at 45 or 50.

every bike has a proper functioning speed range and limit and one must try and develop the knack of extracting the maximum from your bike without harming your bike.

if you still feel you need more help call me at 9941338179 i live in chennai my name is sudarshan and a good friend of deepak raj.
Tejaswin on November 13, 2008 at 5:02 am

Hi i am Tejaswin Iam living in B’lore i have pulsar 150 black 6months old .. i am getting a milache of 38 wear as my friends are getting as 45-48 kmpl i kick my bike in morning 6:00 idle for 1 min and later drive it … my gear shifting technique is
1gear-0 to 12
2Gear-12 to 20
3Gear-20 to 28
4Gear-28 to 35
5Gear-35+
i ride in city usually at 50kmph

i service my bike regurlaly .I have completed 4400km i put oil every
1200 km but im not happy wit milache it give …….i complained to the dealer changed the oil stump but no improvement in milache i tried putting SHELL petrol but the increase in milache is only by 2kmpl

Please tell me what to do to increase milache and i am planning to put k&n filter can it increase the milache
Kaleem on November 13, 2008 at 4:10 pm

Hi m kaleem, i ride passionplus 2005last month model…I dont have a outmost knowledge of bike tips as i riding 4rm past 5months .I dont have a maximum usage of it except 4 a 30 2 50km per day .Plz provide me the tips and tricks 4 better milage and performance..
sudarshan on November 13, 2008 at 4:48 pm

hi tejaswin
try to get your bikes carb properly tuned may be the carb and the fuel settings are causing the problems.

does your bike have the correct idle rpm during idling check for the proper idle rpm from the owners manual and see if the bike has the optimum idle rpm.

put fuel from a company operated petrol bunk and stick to one good petrol bunk. use only normal unleaded fuel as the pulsar has to run only on normal unleaded petrol. dont fill fuel more than 15 litres of fuel in the tank.

has the engine been properly tuned during the pre-delivery inspection and during each of the services , the engine can be tuned for performance or fuel efficiency or the stock setting. i suggest the bike has to be in the stock setting as it would give you the max benefit in the long run.

if you put a k&n filter you will lose the warranty, the performance filter will make the engine to breath more freely as the airfolw would be more this results in the bike having more power and pick up. mileage will definitely come down by 10-15 km/ltr.

is the service center you are getting your bike serviced have experienced staff and are they doing their job properly during services, are they carrying out the jobs specified by the company with meticulous precision mentioned by the company. failure to do so the bike’s performance comes down.

the pulsar gives a mileage of 50 in the city and 57 on the highways. do you rev your bike or gun the engine when the bike’s engine has not run for more than 5kms. by doing so the cold unlubricated engine’s valve will experience more wear and tear and might end up bent. you can identify the engine’s wear and tear by allowing your bike to idle and hear the idle sound. if the sound is not smooth and the idle sound has a coarse ruff sound like gatagatagatagatagata then your engine has taken a beating and needs to be worked upon by changing the valves or other parts affected. a drop in mileage is the first sign that your bike’s engine health is not optimal.

use the company specified engine oil. try to get the engine oil changed completely for the 1st 6 services. as the metal parts rub against each other and there would be more friction and less lubrication. the new engine will get heated up more quickly and the engine oil would lose its viscosity and lubricating power due to the heat and friction.

try all these tips and let me know.
fayesal siddiqui on November 17, 2008 at 2:28 pm

hi… i’m riding an RX 100 (yamaha)… it gives me an average around 30kmph…. i have no idea what it shud give actually….

another thing i would like to ask is abt buying a new bike… i’m planing for the new yamaha FZ 16… is it worth it…. i mean whats the avg and would it be fine for a city like bombay…
sudarshan on November 18, 2008 at 4:39 pm

hi fayesal

please go ahead and buy the fz its a the best decision you have made. the fz should give you a minimum of 40 under normal driving conditions in city. make sure you dont gun the engine too much and dont drive the fz rashly. one of my friends tells me he gets 40+ average in the city. the fz will definitely give anything between 35 to 41 in the city depending on your driving style, roads, load, traffic and sorroundings. but anyways go for it, its the best 153cc bike in india and a worthy replacement for your 2stroke exotic the legendary rx100.
sudarshan on November 18, 2008 at 4:41 pm

hi fayesal
your rx is giving you a good mileage for its power, age and pickup its ideal mileage. the fz is the best bike for the city use its very accomplished for city use. like i said go for it.
SARVESH MEHTA on November 21, 2008 at 6:21 pm

Dear frndz
where all od u’ll have writen abt ur geared bikes, i would like 2 tell u abt my non-geared bike

Model:-Honda Activa
Year of manufacture:-2003
displacement:-100cc

my average speed is 60+
top speed:- 90-91

AND MY MILEAGE IS 40 KMPL

now which do u think is better,nd neither do i follow ur above rules

so dude wana race??????????????????????????????/
champ on November 25, 2008 at 10:57 am

hi i own a hero honda karizma r n my bikes fuel efficiency is:
city= 40kmpl
highway= 53kmpl
the idea behind getting high mileage in city is to run the engine in top gear 3-5 as far as poss the more the top gear the more is the mileage..u have to attain this by shifting gear as soon as ur tacho needle ticks 3000rpm for every gear…try n c the results…also correct tyre presuure,braking,preventing sudden throttle,way of changing gears,not keeping bike under direct sunlight would add to it
Amit Prajapati on November 27, 2008 at 6:10 am

I have own Pulsar 150 DTS-i Purchased on 14th October 2008, Till now it gave me a 58-60 Kmpl in the City and 62-65 on the Highway i have checked by myself and by my friends itself and they said that it’s your luck that your engine may be best made by bajaj productions……..because i have heard from some of the people that it gives only 45-50 on highway as well as on the city….but believe or not it’s true for me….

Thanks for your tips…
Prasanna on November 27, 2008 at 9:48 am

Hi Deepak,

This is the 1st day I am reading your reviews…………its good and very useful tips that one has to know. I am having a Royal Enfield Thunderbird Twinspark which gives me 43kmp/ltr in city and I have not tried it in highway as I have not completed its running-in.
sudarshan on November 28, 2008 at 3:12 pm

hi champ
thanks for sharing great tips dude. even i have a karizma r and i get 41 in city and 49 on highways
Deepak on November 28, 2008 at 3:51 pm

“even i have a karizma r and i get 41 in city and 49 on highways”? What are you talking about Sudarshan, it was you I was talking about in the post!
Freak on December 2, 2008 at 11:11 am

hey ppl….
im buyin a bike early next yr, probably jan second week…i have short listed to either FZ16 or p200… im bit of a rash driver… love zippin past da traffic.. mileage s a main factor for me cos i drive around 50 km to coll daily. i wud like to know da better option… da prob i find wid FZ s tat its not for highway… goes pretty quick till 60 then drags it all da way to 70.. p200 dominates here… so ne chances of gettin a 50km\l on it !!!!!!
Prasanna on December 3, 2008 at 4:31 am

Hey Freak,
If you are a rash driver, you should not be so concerned about the mileage factor. But w.r.to your decision b/w the two bikes. I suggest you to go for pulsar 200, as it has got a good wide tyres and a superior braking. Don’t worry about the mileage as in long run it would be equalized. My humble request for you is to rash your bike after top gears which gives you good mileage when compared to rash driving the bike within the top gear speed.
Freak on December 3, 2008 at 5:49 pm

thanks man… i ll keep tat in mind… n by da way i think da FZ has broader tyres…
sathish on December 4, 2008 at 6:49 am

hello im sathish,iam a TVS apache rtr160 owner,my bike is giving only 40-45,can i improve my mileage guys,any one help me
Navaneeth on December 5, 2008 at 7:59 am

Hi,
I am using Apache RTR 160, I have put K&N air filter from the day i purchased the bike and I haven’t felt any difference in pickup or in the mileage, could you please help me giving a suggestion what could be the problem in my bike.
Navaneeth on December 5, 2008 at 8:00 am

Mileage is about 38 to 40 km/p.
sudarshan on December 8, 2008 at 12:35 pm

hi satish
the apache rtr has an oversquare engine so the mileage your getting is good for the city use i dont think the apache will give more than 45 in city use.
sudarshan on December 8, 2008 at 12:40 pm

hi navaneeth
the k&n filter makes the engine breathe more freely so the mileage you are getting is good may be the bike can give you 40 but thats about it, your bike will have more pickup and slightly more power than the other stock rtr’s drive any other rtr so find out the difference.

k&n filters are high performance filters so 38-40 is a good mileage in my opinion considering the rtr has high revving oversquare engine.

and dont adjust the tuning let the company settings be as it is to ensure the engine has longer life
zakirali on December 14, 2008 at 12:00 pm

hi
I’m zakir from bijapur (karnataka), I have HERO HONDA SPLENDOR PLUS bike 2007 model. my bike is not giving sufficent mileage compare to other same bike’s from 2nd service to last free service(that is 6th) in showroom i complained about worst mileage & said to increase mileage of my bike but till now my bike is not giving more then 45-48km per litre. so plz give ur advice .
Pravin on December 16, 2008 at 9:34 am

Hi,
I am Pravin from Mysore and I own Apache 150cc. I get around 55 km/l
I drive in the economy mode 40-60km range maximum. I am planning to fit it with K&N filter R-1060 as my friend suggested that it would increase the mileage
Factors that Affect your Bike’s Fuel Efficiency | BikeAdvice.in on December 17, 2008 at 3:27 am

[...] so that you do not forget the key points. I have already posted some tips for inproving your bike’s mileage. Here are some factors which affect fuel efficiency. I hope you find it [...]
Rahul on December 17, 2008 at 11:58 pm

Hi
I’m from b’lore…
I own a honda shine…about 6 months old…It has been serviced thrice…but i get a mileage 35-40!!! I don’t understand y…My driving is pretty smooth, accelerate smoothly, don cross 55…And I mostly drive on d highway…but still d mileage is pretty poor…
Please help…
Digvijay Singh on January 10, 2009 at 6:04 pm

hi iam from Jodhpur..i own a bajaj pulsar 180 dtsi..its 6 mnths old…its givin a mileage of 42kmpl..i dn ride very roughly…n generally dn cross 50-55kmph…is my bikes avg good enuf??plz reply…n ya i wntd to know if i cn fit a pulsar 200cc silencer in my bike?hw much wil it cost?plz help
Nikhil on January 17, 2009 at 7:24 am

Hi, I have Honda CBF Stunner 125cc bike. Honda Unikorn, a 150cc bike gives consistent 55-58 Km/lit mileage in the city, so, I thought Stunner will definitely give me 60-63 Km/lit mileage as it is an 125cc bike. But its just delivering 50 Km/lit. Why it is so?

Best Regards,
Nikhil
Krish on January 18, 2009 at 6:32 pm

hi iv got the newer model of the HONDA DIO .Its been 3 months since i bought it !! it gives a mileage of onli 33km/l which i think is little! cn u advice me on how to increase the mileage
thanks
Avinash on January 19, 2009 at 1:51 pm

Hello Everyboby,

I have Pulsar-150 bought 1 one month back.
My question is what is the right time to check your new bike mileage. I mean should we check it after 1st servicing or may be later??
rakesh on January 20, 2009 at 6:52 am

Hi sudharshan I am rakesh & i own a supplendor+ bike which i had purchased Four months earlier. which had covered distance of 1100 KM & serviced once on 600 KM on auth. dealer. I used to go office daily on my bike which is around 8 km away from my home in delhi So always my bike cover short distance.First i put choke & kick start my bike & leave for 10 sec. then i used to idle for 1-2 min. & move bike 1-2 km on second gear or third with speed 20-30 then i ride with speed 40-45 in top gear never crossed 50 km/h I changed 2 gear on 10 3 gear on 20 4 gear on 30
The bike give around 60 km/l average in city with covering only 6-7 km in one strech sometimes even 2-3 km only. i think my bike is under performing as it should give 70 km/l can u tell me what mistakes i make & how to improve milage or the bike is giving good average
One more think i used to clean bike with a cotton cloth daily & wased it
in 2 weeks with pump should i use anu lubracant for chaim lever & other joints & use wax on body please suggest good lubricant & wax thanks in advance
Ratheesh on January 22, 2009 at 7:23 am

Hello sudharshan,

I am Ratheesh stays in kalyan. I bought Honda Shine in november. I always have to give choke during cold start is it advicable as you have suggested above.

Also after 40km/hr bike vibrates, is this because there is further room for engine and gear to smoothen or is it a drawback of the design of teh bike. Please do suggest me on this and how can i reduce this vibration. Is there any specific or better engine oil that can help reduce vibration and starting problem. One of my freind did suggest me add-on lubricant that smoothens the gears and increases the mileage.

I was able to touch 80km/hr and was in control and balance. i am planning to test further its limits after it crosses 2000km.

Otherwise the bike performance is really good. Eccept i feel is the bike continues to vibrate it might cause future problems for maintainance.

Plz advice.
pranay jaiswal on January 26, 2009 at 4:17 am

hi,
I had a honda dio,it is good moped but it gives average of 45km/pl.advice me to increase its mialage upto 55.
waiting for help………..
dinesh on January 28, 2009 at 4:37 am

hi guys ,

i brought a new pulsar 200 3 month ago. it has all in it. but the mileage i am getting when comapred to others is 33 in city highway yet to try. i am pissed off with this.i dnt drive rashly. can u guys suggest wat the prob with this. how to increase my mileage.
Sandeep S on January 31, 2009 at 4:01 am

Hi this is Sandeep S,
I own a Passion Plus bike which is 2 yrs old. It gives me an average of 40km/liter, am not satisfied with it. I expect atleast it should be above 55km/litre. How can i improve it?
Kindly guide me, thanks.
sahil jain on January 31, 2009 at 4:28 pm

hello deepak
i ve decided to purchase a new bike
i want bike in cool style , good mileage ,
can u sugest me stunner is good or pulsar 150 or apache
Jeyakumar on February 10, 2009 at 6:30 am

i would like to buy a bike. i specified following. which one be best & give more mileage.
1.suzuki GS150R.
2.Pulser 150
3.CBZ Extreme
4. Yamaha FZ16
abbas on February 11, 2009 at 6:00 am

hi jeyakumar please consider apachertrfi sweet bike in the above list go for fz16
Murali on February 16, 2009 at 11:21 am

Hey sudarshan,

Thanks for sharing with regards to mileage. I recently bought Thunderbird Twinspark and it gives 40 km/per litre approx. I just have one question wil the mileage wil get affected if we frequently use the clutch like shifting the gear in a short span of time ??

thanks
Govindarajan M on February 16, 2009 at 12:24 pm

I have a RE Thunderbird. I need to change the silencer which will give me a loud thumping sound of a bullet without degrading the mileage. I get a average of 35 to 40 km per litre. Is there any way i can increase the mileage.
Arul on February 17, 2009 at 2:48 am

Enticer – 115cc
16700 kms
Mileage 35kmph with unleaded, 39-40 with premium.
Will try your advice for a couple of week track it again
sandeep on February 18, 2009 at 5:58 am

hi,
my name is sandeep n ihv bought a pulsar 150 2003 model how to increase its milege its mileage is around 45KMPL n its accleration is more due to that reason its crating a lot of vibration my bike topspeed which it is giving nw is 120 it starts vibrating at 90 socan u please suggest any………. n one thing i also want to increase the beat volume in my bike with out decreasing its mileage u can advice me about that also k waiting for ur advice
sandeep on February 18, 2009 at 5:59 am

hi,
my name is sandeep n ihv bought a pulsar 150 2003 model how to increase its milege its mileage is around 45KMPL n its accleration is more due to that reason its creating a lot of vibration my bike topspeed which it is giving nw is 120 it starts vibrating at 90 socan u please suggest any………. n one thing i also want to increase the beat volume in my bike with out decreasing its mileage u can advice me about that also k waiting for ur advice
Recks on March 5, 2009 at 7:03 pm

Hi,
I own a Apache RTR and it provides more than 50 mileage in city.
anand on March 6, 2009 at 5:27 pm

I’m Anand and i own a Pulsar 150 2008 model. I get to run for 48 to 51 kms within city and 58 to 60 on highway.
abishek on March 10, 2009 at 3:08 pm

I’am abishek i have a bike yamaha gladiator type rs.it gives 62kmpl milage
aashu on March 10, 2009 at 3:19 pm

i have a hero devil bike.i don’t have mileage problems because it does’nt have an engine.i can go as far as i want with out spending on petrol.it’s eco’friendly.it helps me keep fit.so fuck all u bike owners’
siddharth on March 24, 2009 at 3:14 pm

Hi,
I own a FZ-16(black) which is 5 months old……in the begining it gave around 37kmpl in city ….but after two servicings, it started giving a mileage of 41 in city and 46 on highways……..i personally feel its still low on mileage can u suggest any fuel efficiency tips to increase my bike’s mileage
thiruvarasan on March 28, 2009 at 8:18 am

hello guys,
i’ve yamaha gladiator SS
it has done +5,000 kms
it gives me an average of 50-55kms/litre

i always ride at 60-70km/hr since i’m going to my college which is 15km form my home
i’m happy with the performance, comfort and unbeatable braking system that yamaha has.
Titus on April 2, 2009 at 2:40 am

Hi!

would like to share some of my experiences with mileage
I own a Pulsar 180 UG3 2007 model
It gives me 57 km/l with 120/80 modified rear tyre and mixed city riding
It drops to 41 to 44 km/l (speeds 70-110 range)
To derive the max out of ur engine drive at a constant speed of 45 to 50, this is where the economy zones works and be patient in initial pickups at signals etc. Thanks.
Digvijay on April 3, 2009 at 1:37 am

dude i cant blv it…my Pulsar 180 UG 3 is giving just 45kmpl…i ride at a constant speed of 45-50…the company claims 50kmpl…hw cn u get 57 kmpl????have u made sum other changes in ur bike?plz do reply asap…
Rajesh T on April 4, 2009 at 6:27 pm

I have a SUZUKI SAMURAI. The no problem bike. gives a mileage of 37-40 in traffic and 40-43 on highways. I got it second hand bike and in 13 yrs old.good engine beat. is the mileage good or can b improved???
manish on April 6, 2009 at 5:28 pm

I have purchased passion plus in oct2008. Before 1st servicing i was gettign an avg of 50. Afetr giving the bike for 1st servicing my avg declined from 50 to 40 and finally. i visited the service centre and still teh prob persists. Iam still getiing 40avg. I drive my vehicle at the speed of 45-50 on highway and use the spped as specified on the spedo meter regarding changing of gear. I am really feeling at loss of money for petrol. I dont hav any other issues but the only reason i purchased this bike is for mileage or i would hav gone for pulsar. pls help me out.. what to do to increase the mileage
Harsha on April 7, 2009 at 4:43 pm

hi everybody
this is harsha from hyderabad, i have honda shine bike which gives a mileage of 62-64 KM (at Avg. speed of 50km) in city but when i go for a long drive i.e, out of station my mileage is decreased. can any one help me with this…
Harsha on April 7, 2009 at 4:47 pm

hi everybody,
this is harsha from hyderabad. i am having a honda shine ( 2008 model. it gives a mileage of 62-64KM (at an avg. speed 50km) in city. but when i go for a long drive my mileage is decreased. can any one help me with this please. my id is harshavardhan42@gmail.com
Morfy on April 14, 2009 at 12:43 am

HI dudes good to see the tips of getting the Averages

First of all I wish to mentioned that I own four bikes

HH Karizma R—————Avg-42 city,52+ highway
HH CBZ (old model)———Avg-45 city,53+ highway
HH Passion—————–Avg-57 city,65+ highway
HH Splendor (Basic model)–Avg-65 city,70+ highway

But I surprise the conditions when full tank of Karizma gives me average of more than 50+ in city , and 57+ highway

This will improve my Karizma average then I try it to all bikes and ya this will work and i get average improvement abt 10+ on every bike.

The idea of run the bike

1.average Speed ——55-60 for karizma, 45-50 CBZ,35-40 passion and splendor.

2.Choice the right gear and increase and decrease the gears on right time.

3.Maintaining accrurate tyre pressure.

4.Chain of bike should not be tight or loose.

5.Right time to change the engine oil.

6.Proper Servicing.

7.Breaking should be checked , specially in the case ur bike having disc break , beacause sometime disc break little contain friction because of dust/mud and this will choak the bike flow and decrease the average.

4.Make sure ur petrol pump provider provide u the accurate fuel and clear fuel(some petrol pump provider contain fuel with mixture of things in petrol, damage ur bike engine and average).

Thanks to all for wonderful tips enjoy.
Morfy on April 14, 2009 at 12:55 am

Hi harsha ,

I got ur problem
actually what we do is that in long run increase the speed of bike which causes more consumption of fuel and decrease the average of ur bike.

The second reason is that you have to cool down your bike in aroun 75km run in once so that engine takes rest and ready to burn fuel at the efficient terms.

Thanks
hemant on April 24, 2009 at 4:02 pm

HI SUDARSHAN,
I M IN DILEAMA WHICH BIKE TO BUY? LOOKING FOR BIKE OF 125 CC WITH GOOD MILEAGE. CAN U HELP ME TO LOCATE?
ram on May 1, 2009 at 9:38 pm

hi deepak
i own a fz 16 and after 1st service i got mileage of 44+ and now after 2nd service its only 35 maxmium wat 2 do with such problems? plz help me out
Deepak on May 2, 2009 at 7:49 am

Don’t worry Ram. Check the mileage for another few times and let the numbers average out.
Karthick PK on May 12, 2009 at 4:35 pm

Tejaswin: Hi i am Tejaswin Iam living in B’lore i have pulsar 150 black 6months old .. i am getting a milache of 38 wear as my friends are getting as 45-48 kmpl i kick my bike in morning 6:00 idle for 1 min and later drive it … my gear shifting technique is1gear-0 to 122Gear-12 to 203Gear-20 to 284Gear-28 to 355Gear-35+i ride in city usually at 50kmphi service my bike regurlaly .I have completed 4400km i put oil every1200 km but im not happy wit milache it give …….i complained to the dealer changed the oil stump but no improvement in milache i tried putting SHELL petrol but the increase in milache is only by 2kmplPlease tell me what to do to increase milache and i am planning to put k&n filter can it increase the milache

Dear Friend,

I have some small suggesstion…
Sorry for that..
I have Honda Unicorn and 180 Pulsar..
I Use to put Shell petrol..for my both bikes..
after over period of time bike started making noise in the engine in both bikes..
I have cross Verified with mechanics and service centers they are telling the same..
I love my bike so much more than me..
Now i am using Normal Petrol..
Only Unleaded petrol other than Shell Bunk..

MY ID : pkk_kunna@hotmail.com
prince on May 13, 2009 at 7:12 pm

hi plz tell me everything about the bajaj discover135cc dts-i its power , comfort and the most important thing also teel me about its breaking system . u know i love the bikes in disk breaks. and on the discover at what speed applying the front disk is safe.
Karthick PK on May 14, 2009 at 11:18 am

Hi Discover owner..

It’s Cool Vehicle…
Bajaj bikes will listen to sigle hand users only..
dont give the bike for rides for anyone for long drive and all..
dont doo the Whelee so often..
Mileage is pretty fine 60+ for the decent drive in city condition..

Dont drive fast so often chasing with that bike since it’s light weight bike it wont listen for our sudden braking unless u are confident about braking..

Always use 60% front brake and 40% Back Break for better braking.
While doing fast drive use 50%Front 50%Back braking that sounds good braking..

Always dont trust bike more then your confident..because tyre pressure,road condition are important..
use the braking accordingly.

Apply slowly not sudden brake..

other wise the bike is really great and smooth
always get the vehicle serviced properly..
prince on May 14, 2009 at 1:57 pm

hi plz tell me everything about the bajaj discover135cc dts-i its power , comfort and the most important thing also teel me about its breaking system . u know i love the bikes in disk breaks. and on the discover at what speed applying the front disk is safe.
MY ID: s.ramanbir@yahoo.com
Jeet on May 25, 2009 at 4:40 pm

Hi Guys,

I am going to get my first bike of my life n that is Karizma Black this weekend. As i have not driven any bike much in my past, i have few queries to ask. It would be appriciable if any one of you can give me right feedbacks:

1. Some people say that karizma skids while applying breaks all of a sudden. I would like to ask that in heavy traffic, how good is the control of a Karizma?

2. As there are no leg-guards in karizma, should i get it for safety or is it ok without it?

3. What is the throttle and how it is used while driving a bike?

4. Which helmet i should buy that will compliment karizma black?

Cheers!!
Mayuresh Athalekar on May 27, 2009 at 1:33 pm

I own Yamaha CRUX 2001 mode. It gives me @ 50 Kmpl average. I am intrested in some suggestions to keep the engin performance better. Apart From regular oil change what are measures / tips that can help to improve or maintain the engin condition.
Anuragi on June 5, 2009 at 9:39 pm

i have yamaha fz16 2008 model. i drive it about 5000 km but it give 32-35 km/pl in city and 35-38 on highway
pls suggest me how to improve
Anuragi on June 5, 2009 at 9:47 pm

i also have this problem yamaha fz 16 does not gives more than 35-36 km/pl
zakir on June 6, 2009 at 9:09 pm

i have hero honda splendor+ 2008 model. i drive it about 9000 km but it give 40-42 km/pl in city and 45-48 on highway
pls suggest me how to improve mileage
Nagesh on June 8, 2009 at 3:13 pm

hi friends
I got new CBZ extreme2009 model
what is initial speed of first 1000 Kmts
pl suggest
hemant on June 8, 2009 at 4:29 pm

can anybody tell me excatly how to cal the mileage? i ve owned Gladiator ss.
Deeps on June 9, 2009 at 11:30 am

hi sir
u told about the warm up process between bike and a guy in gym for the best mileage it was really a good explanation and i jus wanna know 1 thing is that this should be done every time i start my bike or starting for a first time in the morning? pls help me
Mayuresh on June 9, 2009 at 1:08 pm

Guys,

It looks like we have pile of questions and there is no answers coming from experts.. ?

MODS / Thread owners / BIKE EXPERTS can you please post answers ?

Regards,

Mayuresh
Deepak on June 9, 2009 at 7:19 pm

Only in the morning you can warm up your bike……

Then every time you start the bike wait for 10-15 seconds and start biking…..

Have a nice riding…
Shahbaaz on June 16, 2009 at 2:36 am

Answers expected…
I read all the queries expecting answers from experts…but nothing.
There was a query regarding fitment of scilencer of 200cc Pulsar to 150cc old Pulsar…
The same is with me…
But there was no reply….
PLease do reply…..
pradeep on June 18, 2009 at 1:24 pm

hi friends one day before i purchased new cbz extreme ATFT, but my bike is idling at very high rpm(3000) i know it is correct. but some of my friends told me that in case of new bike mechanic set it high after that he will tune it to 1400rpm(ideal idle). is it so?
one thing more when i turn my kick lever in kicking position (when vehicle is already ON) i sounds KIRR KiRRRR. why?
is there any problem with my bike?
plz sort it out.
pradeep on June 18, 2009 at 1:26 pm

read Very high rpm(3000) i know it is not correct
uday on June 21, 2009 at 12:16 pm

hi guys i am frm hyderabad, i am riding a passion plus red colour. i never go below 70kmph on highways. i drive it very rash. even then i am gettin nearly 50 mileage in city nd 55+ on highways. i travel a minimum of 30km daily. it has completed nearly 18000km in 1 nd half year.
hitesh on June 21, 2009 at 11:40 pm

hii sir i have apache rtr 160 cc.
and i got an average of 35-37.
how can i get good average on what speed i will drive my bike.
pls tell me.
thanks!
Vinod V on June 25, 2009 at 12:48 pm

Hiya Vinod here living in kochi, I hav hero honda ambition 133,it is 6 yrs old now, in d initial stage it gave me 54kmpl bt now m gettin jus nearly 34-36. I jus want to increase milage of my bike.Plz giv me some tips to increase milage…

vinod
Ramesh S on July 1, 2009 at 9:10 am

Iam using Discover 135cc (Black w/Blue line sport type model) for the past 16 months…I haven’t faced any problem till now…really wonderful bike…I gives mileage about 54+, if you drive <60 Kmpl…otherwise 45 to 48 only…Overall it's good bike for all….(youth, middle age & bit old people)….
raghav on July 2, 2009 at 10:03 pm

hei i have pulsar 150?
n on highway it gives above 65 average and in city it gives around 42?
ehat to do
Mrinnal on July 3, 2009 at 7:44 pm

Hi deepak …
I own a hero honda super splendor since 1 yr … my bike has clocked 3024 km … the problem is that my bike gives me a milage of only 35kmpl ….. I think this milage is very low … I m a speed freak !!! so i drive my bike at a speed of 60-80 kmph … Please do answer my question i am waiting for your response ….
Mrinnal on July 3, 2009 at 7:49 pm

hitesh: hii sir i have apache rtr 160 cc.and i got an average of 35-37.how can i get good average on what speed i will drive my bike.pls tell me.thanks!

drive ur bike at a minimum speed of 50kmph,apply less brakes,and drive your bike smoothly… this is it
rizwan on July 20, 2009 at 2:23 pm

hi,
i have a fz16 on the highway its giving avg of 27-28 and in th city its givin 32-35. which i think is vry low. i drive my bike at a speed of 90-100 kmph on highways by not shifting th gears much….pls advive me hw to incerase th milage…

rizwan shakil
ankush navratne on July 21, 2009 at 7:49 am

hii friends ankush here….
m goin buy KARIZMA red color this week..
i have 2 drive it more then 25 km a day..
so plzz tell me at what speed should i drive it probably..
50-60?? is it ok??
Karthick PK on July 21, 2009 at 9:50 am

Hi KARIZMA Red Owner,

Congrats!!!!

It’s Coooool Vehicle and powerful too

always drive the bike between 45 to 50 in same acceration not tp and down speed..

Try to maintain the speed between 40,45,50 at the max
unless it makes clutch noise u can drive in that speed…

U can drive upto 55 speed..

Don’t do Wheelee or sudden pickup like other’s so often
it leads lack of engine power after some time…

if you maintain the same it’s not just a bike it’s like a ship….
Such a Excellent bike..
Fantastic bike and amazing comfort with nice road grip..

Advance Congrats!!! for the New Bike..
Never drive rash or chase if other stupids tempts you..
if you lose your bike it’s your lover..and heart..
for bike lover’s bike is first rest next..
so never drive rash

Take Care..
Let me know once you brough new bike..
All the Very Best….

Have a Great and safe drive for ever…

ankush navratne: hii friends ankush here….m goin buy KARIZMA red color this week..i have 2 drive it more then 25 km a day..so plzz tell me at what speed should i drive it probably..50-60?? is it ok??
Kaushik on July 23, 2009 at 4:18 pm

hi frens this is Kaushik..

i own a pulsar 150 dtsi 2005 model.. I’ve run it for abt 30000 kms. my bike’s performance is reduced considerably.. pickup is down n mileage is just 30. sometimes below tat.. my bike desperately needs help.. i’m not much into these bikes n stuff n don’t know much abt them.. mind you i’ve not done any kind of modifications to my bike. so guys pls help me out… what could be done to increase the performance? guys i’m countin on u…
Akhil on July 25, 2009 at 6:46 pm

I am living in Indore & I want to buy a bike within a week.
I want to buy a Karizma & mileage is a concern for me. I asked many Karizma users from my city & the avg. mileage I recorded was 25. Is it possible to get mileage any where near 38-42. Pls enlighten me.
Riyaz on July 29, 2009 at 10:03 am

Hi
I have Bajaj Discover 125 CC spokes version bought in 2005. the bike used to give me good mileage for all these years except once there was a hole in Silencer which after rectification got resolved and the mileage came back to 52 Kmpl in city. but lately again it dropped down to 47 kmpl after I gave it for servicing. since then they have not been able to understand as to why the bike is not giving the desired mileage. they have checked the silencer and its packing and what not but all thse have not improved the mileage. Please advice.
Ramesh on July 31, 2009 at 12:14 pm

Hi Frnds,

I have Discovery 110CC (CT 100 Engine). The mileage am getting is 45-50. I ride between 40-45 kmph. smooth rider. still the mileage is same. As its a CT 100 engine it should give more mileage than 135CC. Anyone who knows how to improve Mail to aaru2u@yahoo.co.in. or reply in the same. Thanks.
Manoj on August 11, 2009 at 3:57 pm

I have super splendor self start type byke. The bike is alloy wheel type. I want to know how much air filling in both tyres front and back.

Please let me know. beacause i have only get 45 km/l mileage

Manoj. M
harendra on August 11, 2009 at 6:52 pm

Hi,
i have Hero Honda Passon pluse, my bike(4 years old) run over 20000 Kms, but the problem is that my bike gives avg. 53Km/L on highway (bike never given avg. 53+). Please help me out to improve the mileage, because its not a sufficient avg., bike should give more than 65 on highway. the condition of my bike is very good, pickup also high. i have use proper gear shifting accoring to speed.
Please help me, send ur suggestion on my e mail ID: harendrasinghvimal@gmail.com
Thank you
Ashutosh on August 17, 2009 at 11:14 am

Make: Bajaj Pulsar 150 DTS-i
Model: March 2005
Mileage: City : 55-58 KMPL Highways :>60 KMPL

I love the performance of my bike. I have only replaced battery of bike since 2005. Its virually maintainance free. But you need to service it regularly.
kiran on August 20, 2009 at 5:02 pm

i hav rx 100 1996 model japan.it gives me milege about 25 km/lgive me some tips to increase my bikes milege plz,,,
kiran on August 20, 2009 at 5:04 pm

i hav rx 100 1996 model japan.it gives me milege about 25 km/lgive me some tips to increase my bikes milege plz,,, and i have a pln to modify my byke to a dirt byke so what would it cost me for it,,
Arijit on August 24, 2009 at 2:41 pm

i m having Yamaha RX-Z 132cc,1998 Model. My Baby gives me Exact 50 Kmpl Mileage.But i want to increase my bikes mileage plz give me tips
Subroto Bhattacharjee on August 25, 2009 at 6:45 pm

Hi,

I am having Pulsar 150cc upgrade model UG4.
My bike is giving a mileage of 42KMPL.
My gear shifting is usually like this:
1st – 0 – 10
2nd – 11 – 18
3rd – 19 – 25
4th – 26 – 35
5th – 36 – …

i mainly drive in a average speed of 45 KMPH.

Request you to please let me know whether my gear shifting is fine or not? Does this gives a high load on the engine? Do I need to change this range Gear shifting? what should i do to improve my Bike Performance as well as its life.?

Please do reply….
Awaiting for you reply….

Thanks in Advance.
Prax on August 26, 2009 at 9:58 am

my zma gives a mileage of 33 with an average speed of 60kmph
vinod on August 26, 2009 at 9:17 pm

my discover135 gives 35kpml wat can i do to increase mileage?
pls advice me
naveen on August 26, 2009 at 10:05 pm

hi, this is naveen sundar, chennai,
i am having herohonda splender
my gives 65 kms mileage,
i am studing mechanical designing
sharath on August 29, 2009 at 12:58 pm

hey
i have a 1995 kinetic honda. i hold emotional value to this vehicle but my only reason of concern is that its a two stroke vehicle resulting in me buyin a litre of kinetic 2t oil from indianoil once a month.!is it the same with others? and i barely get a mileage of 20 with this in optimum driving conditions.im a student and hence my major chunk of my pocket money goes in this.any1 can advise me as to wat to do to reduce the oil consumption and increase the mileage??
thanx sharath
siva on September 2, 2009 at 4:16 pm

i wish to buy a cbz wht i should do to give more mileage for my bike
ravi on September 4, 2009 at 6:59 pm

im using cbz xtreme from feb-2009. i got services from hh dealer.im getting 42kmpl in city driving conditions, is it correct mileage or not.plz give me reply..im a great lover of cbz the time when it is launched
Abhijith R. Makki on September 10, 2009 at 2:39 pm

Hi!! I’m using my dad’s HH Splendor ’98 model(The 1 wid an old stlye silencer! The sound ‘s awesome!!!!). I get 60-63km mileage in Bangalore city.
EJAS on September 14, 2009 at 6:13 am

HI,I Have a Pulsar220fi and am really satisfied with its mileage around 44 kmpl and i ride like a speed 0f70,80.
sathya narayanan on September 17, 2009 at 3:39 pm

sir i have starcity es alloy 2008 model i want to know my bike mile age so kindly help
Vinaya on September 22, 2009 at 8:13 am

Hi, Good to know about your tips.

I am using Pulsar 180cc UG4 model and its been three months as of now.
The new bike is little heavy compared to UG3 model and thought this might have a direct impact on mileage, surprisingly I was getting a very good mileage around 64 to 67 KM regularly until I gave it for first servicing . Now the mileage is dropped from 64 to 58 KM . I always ride my bike around 50 to 60 and some times 70 to 100. I can achieve this mileage only if I maintain the tyre pressure 28/35.
gangadhara on October 1, 2009 at 12:46 am

Hi All,

i purchased used discover 125, i tuned the fuel screw to 3.5 times from full tight and then adjusted the idler to slower rpm now iam getting 60k on highway as my riding speed on highways is around 70 to 90 my engine rockz and didnt seen any vibration s better all u try this settings start from 2.5 revolutions to 3.5 in between that u will get good result
ashish bhatt on October 4, 2009 at 8:05 pm

how to increase my pulsar 220 DTS-I`s average??
ashish bhatt on October 4, 2009 at 8:07 pm

which extra parts can i remove so as to reduce excessive weight of my pulsar 220 DTS-I? plz inform abt this to me as fast as possible…
Manish on October 9, 2009 at 6:59 pm

i hv yamaha fz16 …15days…covered 490kms…its giving 27-30 kmpl…:(
plz advice…
its killing on my pocket…
vinod on October 11, 2009 at 11:09 am

my discover 135 gives 40kmpl pls advice me
sandeep on October 14, 2009 at 11:09 am

hi myself sandeep i m thinking to purchase yamaha fz 16 but i m very comfuse about the milege
kindly tell me the correct milege of fz16 and some tips to increase it
Deepankar on October 14, 2009 at 11:10 pm

Hey friends,

I recently purchased Apache RTR 160 ( about 20 days back) and my bike is giving an average of only 30 kmpl. Is there any adjustment needed in the new bike?
I always use XtraPremium petrol. Does it make any difference if I switch to normal one?
Also my bike’s ignition frequently turns off while driving. What should be the exact problem?
vinod on October 16, 2009 at 7:26 am

dont rise the engine for 1000km
as my dis 135 took this problem at first
Jesse on October 21, 2009 at 10:51 am

I have a royal enfield electra 5 geared with electric start and disc brakes. I get a fuel efficiency between 32-34Km/L.
Anuragi on October 21, 2009 at 7:45 pm

i m regular reader
i have my Yamaha FZ16 with 8000 km dirven
before reding this forum my bike never give me more than 25-28 kmpl after applying all of ur tips like before start bike warm up no extra weight tyre pressure a found it 32-36 kmpl

i want to give one more suggessin which i feel myself if we ride FZ16 with 80-85 kmph we should wear skin tight jacket or cloth and remember cloth should not be loose otherwise it will effect ur riding
Anuragi on October 21, 2009 at 7:48 pm

sandeep: hi myself sandeep i m thinking to purchase yamaha fz 16 but i m very comfuse about the milegekindly tell me the correct milege of fz16 and some tips to increase it

FZ is a better option in comparision 150cc bike segment FZ16 give 30-35 kmpl in city 40-45 highway i have this bike since last year
Anuragi on October 21, 2009 at 8:00 pm

Manish: i hv yamaha fz16 …15days…covered 490kms…its giving 27-30 kmpl…:(plz advice…its killing on my pocket…

don’t worry dude
before 3rd service this bike give 25-30 kmpl after that keep bike proper maintain like dont use extra weight like diggi if u r using diggi it should be aerodynamic keep air pressure 40-45 rear 30-35 front chain shuld not loose or tight and most important disk break should not make friction. u can check urself drive ur bike 3-4 km without applying front break after that touch disk break disk if this is hot, adjust it
sathish07 on October 24, 2009 at 8:56 pm

can anyone suggest me for discover 135
my bike gives milseage of 46 kmpl
pls advice me.
thanx
sandeep on October 26, 2009 at 9:06 am

plz tell me the milege of apache 150
sam on October 27, 2009 at 12:45 am

if u guys are talking about mileage then talk PLATINA it gives 60-65km/ltr in city and 70-75 km/ltr in highway…..its a good bike,the heavy bikes cant give so much mileage
Chandru on October 27, 2009 at 12:47 pm

Hi,,all,,

Am using Yamaha FZ-16 its giving exactly 35 in city condition..and 38 to 40 in high ways,,it almost complet 11000kms in 10months..
Dinesh on October 28, 2009 at 7:37 pm

hi guys..
i i’ve booked a pulsar 220 carburetor version……… i like to know the mileage of it..? so plz help me
PSR on November 1, 2009 at 4:13 pm

Hello…!

I am having Splendor – year 2003. In starting it gave me mileage of upto 68 Kpl, but now it is giving only 52-55 Kpl,
..I keep care of my bike, and give it for serving regularly…. can u pls advise how to improve present mileage….

If it is not going to improve… may go for new bike…. pls advise which one to buy… mileage and value for money are the requirement….. Usually ride in city for 10-15 Kms per day… and twice in a month go for 120(return) Kms travel.

Pls help.
PSR – KUTCH
Srinivas on November 2, 2009 at 6:06 pm

hi.. guys…

Ive got a pulsar of 2005 ending model…..

condition was superb…… Engine smoothness was Good…. gear shifting was also smooth… only once my cdi unit was gone(current coil..)

remainig all was good…

Do u believe me my pulsar gives above 80 kms…mileage when it was riden at speed of 40-50 in High ways……..

In city it gives 65-70….

my mech also doesnt believed it… ive showed him in mileage test by taking 100ml petrol it gave 8.5 km….

in long journeys i will drive at 60-70 kms..sometimes 80kms speed then also my bike gives around 70 kms mileage…

Thank god for giving me such a good bike….

u can contact me by my mail… information given by me All was true….. God sake…..
Srinivas on November 2, 2009 at 6:17 pm

Ive forgoten to give a advice to pulsar riders…

To get a good mileage compulsorily use kick stater oftenly… in mornings ang the important thing is…..

The RPM….

dont give throtle excessively…….

By my riding experience from 2002… iam giving this advice…

give throtle upto 3… initally for lower gears u can raise below 3.. slightly more than 3(3 is best) for all gears…

and try to drive at 40-50 if want to know ur bikes utmost milage… this is not a joke (slow driving)… i know…

I want all u dudes also to get good milaege… also u can enjoy performance sometimes if u dont care for mileage….
utsav on November 8, 2009 at 1:54 pm

these r very useful tips for a passionate biker….
Lalit Sharma on November 9, 2009 at 10:05 pm

Hm…….well if we talk about the bikes, there are one animal which is not talked about much but has got something in it. I am talking about all new Hero Honda HUNK 150cc. You all think your bikes are cool, come on the kind of power my bike generates under racing conditions I bet no other 150cc bike can do it. Mileage is about 40-45 kmpl I don’t expext much at high speed of more than 110kmph. Generating top speed of 126kmph with raw power of 14.2Bhp. And the design itself cuts the air because of its two wings on the tank. Sitting posture is designed in such a way, it gives a perfect balance of control at high speed. I think before you talk about other 150cc-180cc bikes, consider The Coolest Hunk as well.

My friends, now pulsar, unicorn, apache are gone…

THERE IS A NEW FISH IN THE SEA.

Cheers!!!
udaya on November 10, 2009 at 9:37 am

Hey lalit sharma u talk of hunk then what abt YAMAHA R15. i talk abt that bcoz i possess that. it gives me a mileage of 40. i drive it very rashly. i think thats much far better for me. its a perfect bike any 1 can drive. i have bookd for karizma zmr. i will be gettin it in 1 month. i will be mentionin abt that also soon.
Lalit Sharma on November 10, 2009 at 1:10 pm

Lets see, what you have got in your basket. But R15 is a different class. I have no contradictions in saying that R15 is a better bike, no doubts thats why I did not mention in my blog about R15, I wrote about other 150cc bikes like pulsar, Apache and Unicorn.
I have also booked a black Karizma, would get in 15-16 days. I am sure we would have a great time with Karizma. Good to hear a response against my blog. Hope to see more from your keyboard.
Cheers!!!
udaya on November 11, 2009 at 12:25 am

wow lalit thats great u r gettin a karizma. i too bookd for a karizma bt droppd nd pland for ZMR. i prefer R15 than ZMR r any other bike. i like it a lot. i have changd its back tyre. bt still i get a mileage of 40. i have put a magwheel. so i say that bike is the best than all, bcoz if u maintain it a littl bit it will be smooth nd runs good enough.
udaya on November 11, 2009 at 12:29 am

hey lalit u also said a new fish in sea, bt thats nt hunk. its goin to be RR15 thats goig to be released shortly with 180 cc nd 24 bhp which is more than karizma.
ther is also harley davidson, r5 nd many more to be comin mostly in INDIA in 2010-11. So always keep watchin for a big fish. do not get compromised with the small one if u have the chance.
sumit on November 18, 2009 at 12:10 am

i have bajaj pulsar ug4 150cc new one and its give the mileage of 27kmpl is this ok……… i dont think so
Srinivas on November 18, 2009 at 7:13 pm

Hi………. sumit………

This is tooo odd man…

Ur not getting even 40kms….

Better to go for check of carburettor and get your bike serviced….

ug4 bikes are giving too much less mileage… thats true.. but not less as that u get…

I gave some tips above (on Nov2)… better u can follow them to get good mileage….(if u really want mileage..)

And all make sure ur bike get regularly checked and serviced….

post ur comment…..
Lalit Sharma on November 18, 2009 at 8:15 pm

hey udaya,
I mentioned 150cc bikes..
lets be in present.. till now we dont have any other brand better than Hunk in 150cc accept R15..
We would see big fishes as well. but let them come first..
cheers..
balaji on November 26, 2009 at 6:40 pm

i m owning fz 16 man its a master piece
but when comes to mileage factor it sucks man
it gives in city 30
in highway 35
hey, it doesnt mean that i m degrading mi byk and manufacturer YAMAHA
it is first class in byk
gautam puranik on November 30, 2009 at 2:01 pm

i hav a nxg it is a good bike & gives me a satisfying ride .it gives mileage of 58 to 64 kms.
Ajay Chandran on December 3, 2009 at 11:40 am

i hav a yamaha fz16, i’m gettin a mileage of 36 to 42 in the city.
Ajay Chandran on December 3, 2009 at 11:42 am

and the 2nd service is due soon.
jaroos on December 14, 2009 at 7:58 am

Hi,
I have cbz (old model),
I am satisfied with its performance and pick up, but the problem is that I am getting a very less mileage. Max and min mileage that I got is 30 and 23 respectively. I do not accelerate much but I use to ride @ 80-100speeds. I am not interested in riding my bike @ 40-60s . My spark plugs,engine oil are all correct as directed by the company.I am a regular reader of Autocar India and I use to follow the tips and suggestions .I use to maintain the tyre pressure @28 and 32 . I use to change my oils before 2000kms and I use to do all things to maintain my mileage. So will you please tell me the steps to increase my mileage?

As already stated above I need a decent mileage, I am not expecting a mileage above 50 but without 40-45 mileage I cant survive. I am a person who covers about 70kms a day. CONSTANT 80-100 is my speed . I dont use to change my gears frequently , brake or accelerate much. Will you tell me how much is the maximum record mileage of old cbz model? How to get a decent mileage ? Is it possible for me to get an approximate 40or45 @ 80speed? PLEASE help me to solve my problems.

If I use C&N air filters what are the advantages and disadvantages? will it effect my mileage? I need a good speed as well as mileage. I am ready to sacrifice my mileage till 45 for power.Wil cbz old model get 45-50 mileage ?
WILL C&N AIR FILTERS INCREASE
MILEAGE?
BHP?
PICKUP?
I think if the air intake is proper the mileage increases! is it true?
Whether iridium spark plugs and c&n filters increase the mileage?

Suppose if I am going through a small and narrow road should I go by frequently lowering my gears up and down or @ constant low gear ? Is it necessary to put the overdrive gear @ a low speed with slight knoks? Or is it desirable to continue in the same gear?Will it effect the mileage?
SO if I change my filters to C&N will it help me to increase the mileage?

What are the tricks to increase the mileage ?
Is speed inversely proportional to mileage ?
Should i change my filter to C&N to get more mileage?
Should i go at a constant speed between 40 and 60 to get a good mileage?
Does speeding decrease the mileage?
Jagan on December 14, 2009 at 10:10 pm

I bought new honda unicorn.
i did the 2nd service( in 800km) too..
the mileage is around 50kmpl.

I am first time bike rider
Let me know some tips..
jaroos on December 15, 2009 at 8:00 am

@Jagan
whats your av: speed?
@bhishek on December 19, 2009 at 12:47 pm

i have kawasaki ninja and fazer launched in india recently
kawasaki ninja gives an average of 25 and my fazer gives an average of 30 they both are in good condition. Average is quite low what can i do please suggest me……..!!!!!!

THANX in advance
jaroos on December 20, 2009 at 7:05 am

Both ninja and fazer are power bikes.Performance has more importance than mileage. I think you will get about 40 for frazer if u ride and maintain it well.
Vijay on December 28, 2009 at 5:37 pm

Pulsar 150cc 2004 model – mileage is 50-55(kmph)
Vijay on December 28, 2009 at 5:48 pm

Hi Dear,

I hav to buy yamaha fazer on tis month..

Plz let me knw sum suggestion n tips..
also want increase d mileage n maintain it well..
Vijay on December 28, 2009 at 5:52 pm

Hi,

I hav to buy yamaha fazer on tis month..

Plz let me knw sum suggestion n tips..

Also want increase d mileage n maintain it well..

Let me knw speed limit, which is better company for engine oil.
Bhavya on December 29, 2009 at 9:56 am

Hi Guys!

Having read all these posts, I would like to state my opinion too.
I own a splendor 2000 model. Its giving me a mileage of about 55-60kmpl.
I am a college student and drive on the highway often as my college is situated on the highway only.
I drive on the highway at a speed of 60kmph (decent ) but in the city, i drive rash!
But still my bike gives about 55kmpl, atleast!
Now, i want to changeover to a new bike. I am thinking of getting the new pulsar 180 UG IV. But my dad is adamant in getting me an Apache RTR 180 as he says that TVS service, and spare parts are cheaper than bajaj’s. Is that true?
That is because I want the bike for another 2 years after which I will be going out of India for further studies, and behind me, my 15year old brother and my dad would fight for the ownership of my bike.

Please do suggest me if I should go for pulsar 180 or RTR180?
Also I’ve heard FZ-S giving a mileage of not more than 40kmpl. So i’m keeping that out of the league.

Could anyone please help the distressed?? I am planning to get the bike on the 1st of January, 2010.
PLEASE REPLY ASAP!!!!!
Thanks.
Jitender on December 30, 2009 at 8:43 pm

Hi! guys…
I read this review page from top to bottom and found few buddies have posted the very useful and precious tips. Guys actually I’m facing a serious problem with my pulsar 150, 2002, Nov made. Actually Since last 1 month around, a peculiar problem I’m facing and that is, When i run at the constant speed suppose 60 kph then all of a sudden bike start giving a back on to the engine and firing strokes changes like bullet, and i get a feel like I’m dragging something tied heavy with my bike but this problem was not constant and it was for around 1/2 km and after that it’s turns to normal. When i visited the mechanic he did all the setting and cleanups of carburetor and finally he told that i have to replace the carburetor rest everything is fine, but Since he hasa re-tuned my carburetor the bike became in the worst condition and now everytime it’s running like that i’m dragging something with this and bike firing is sucks engine heatup like anything within 10 kms only and engine is chocking fully. I visited 2-3 mechanics but the’y are not able to diagnosed the problem and saying the carburetor problem finally i replace the original carburetor from bajaj showroom but still the bike behavious is same. Sometime it get good settings that time pickup is good but again all of a sudden it give back thrust and as i open the throttle it gives more back and finally i see for full throttle it goes up to 65, in normal condition i tested this bike top speed 105kph and ultimate pickup with 40kpl city milegae.

Please suggest some solution. I want to know that what could this problem be?

Thanks.
jaroos on January 1, 2010 at 10:19 pm

Mr Bhavya according to my opinion HONDA UNICORN is better for you.It is because it gives a decent mileage,look and power….It is the smoothest bike. Parts are costly but the chances for damage is too low. HONDA IS THE BEST BRAND.
Pulsar and apache are good bikes BUT they have a lot of technical problems.
The engine of apache and pulsar is not as refined as the HONDA AND YAMAHA.

Pulsar and apache looses its grip within one or two years.
I
FZ is a good bike, a hit model which is liked by the youth. If you are a good driver then you can achieve a mileage of 45-50 or much above that.(above50).IYou will get a good mileage more than 50 when you become a good driver. The vechicle should me maintained well with prompt servicing and tunning!Apache(you will get the VALUE FOR your MONEY )Apache offers a lot of features @ low cost but as time passes it looses grip.
I STRONGLY RECOMMEND U UNICORN.

FROM
SOORAJ.M.S
(JAROOS)
Sudesh on January 10, 2010 at 5:03 pm

HI BRO!
IM 4M KARNATAKA N OWN A KARIZMA R!!!
actually i have a major prblm wit mileage!!!
the showroom ppl r not gettin throug it even after my frequent complaints !!!!!!
i have done all d best 4 a better performance!! it gives a mileage of around 37!!! can u plz sort out tis problem 4 me????
jaroos on January 11, 2010 at 8:11 am

hi ….

37 is a good mileage for karizma but people have claimed much more mileage….. so pls tell me more about your bike , constant speed,bike year and way of riding!
saim on January 11, 2010 at 10:34 pm

i hv recently bought a pulsar220 dtsi……
n got the tank full. the milage by my bike ws sm where around 20-25 will my milage be inscreased with time wat shud i do to get more milage…….. as ma other friends with same bike r getting an avg of 40-45…….
jaroos on January 12, 2010 at 11:04 pm

To Saim
You will get more mileage afer few services.
Madhu on January 13, 2010 at 7:13 pm

Hi,

I own a Honda Unicorn Dec 2004 model. I get it serviced at an interval 6-8 months regularly. Small glitches, i get it fixed immediately.

I get a mileage of 41Km\Lt.
Lumen Shawn Lobo on January 14, 2010 at 5:49 pm

i got a honda dio… 7 yrs old… city mileage of 44 km and highways @ 58 kmpl… great
Ravikumar on January 14, 2010 at 9:51 pm

guys,
i have my dads Splendor 1995 model it gives me 65KMPL in city didnt check in hi’way. im gonna buy FZ16 (a giant leap)
Ravi
shadab on January 21, 2010 at 8:15 pm

hey i own a cbz xtreme can u pls tell how to increase its pick up and mileage … which filter to buy
jaroos on January 21, 2010 at 8:37 pm

TO INCREASE THE PICK OUT YOU HAVE TO TUNE THE BIKE…. K&N FILTERS ARE THE BEST FILTERS FOR POWER AND MILEAGE
rajan on January 24, 2010 at 5:22 pm

Dear all,
i am using discover 135 new version without disc brake
i am facing very serious problem in mileage i am getting only 40-45 kmpl on road condtion but in undermachine condtion mileage test i am getting 72 kmpl i have checked very thing they is no ploblem Total distance km covered 11000 km and my speed 50-55km regular air check ,use speed petrol only .
Apart from carbetetor tuning, air presure ,driving speed Is there any reason for mileage drop,

Pls suggest me,
Regards,
Rajan Satish
Shubham Singhal on January 24, 2010 at 5:26 pm

Hi…
i m having a Splendour NXG (100cc)
and not having a good mileage,its just 50km/l
other 150cc bikes r having more mileage compared to my 100cc bike.
plz help me>…
yogesh on January 24, 2010 at 5:48 pm

guys,
i have bought a pulzar 180cc, it gives me a average of 32kmpl milege in city,
what shall i do to increase my bikes help………..???
avinash dawra on January 25, 2010 at 10:38 pm

hi guys i hav karizma r n is amazin byk bt nly 1 problrm of average hw should i solve it plz help…..
Ajith on January 29, 2010 at 4:51 pm

Hi guys, I own a discover, its 5 years old..done 34k kms. Iam getting a mileage around 50+ only in city, daily i ride 7 kms to office and back..now a friend is accompanying me..hes a bit heavy too have to check the mileage now.
Adil Shaikh on January 31, 2010 at 12:56 am

i just bought a new pulsar 180 on 12/12/09

it gives me a mileage of only 20-26kmpl

what shall i do??
@bhishek on January 31, 2010 at 11:45 am

Thanx sir for the complement, but what about my ninja can i raise more mileage of kawasaki ninja to around 35? at what speed i shall ride ninja and fazer to get maximum mileage?
@bhishek on January 31, 2010 at 11:47 am

now fazer gives only 25kmpl and ninja gives just 20kmpl
Abhijeet on January 31, 2010 at 11:57 pm

Hi all!
I own a Bajaj pulsar-150cc, 2007 model.
I am getting around 35-37 kmpl mileage.It is in good condition.Is this mileage is normal or It should perform better?
SJ on February 2, 2010 at 5:52 pm

I am using TVS Apache 150 CC from last 3 years. I am getting average of 60-61 KM ya but after driving under good condition such as speed of 40-50 KM, regular servicing of bike, using good additives for engine.
nik on February 3, 2010 at 1:38 pm

heyyyy i got a new karzma on thiz new year bt im really not happy wid itz mileage …itz near 22-25….giv me some suggestion…
Viju on February 3, 2010 at 1:42 pm

Hi,

My bike is giving me 45-50 Km/liter, i know this is on lower side, so kindly guide me.

Model is Tvs Star city-ES 100 cc.Run is 22,500 Km in 2 years,
regular maintainance is done.but still it’s not giving me more milage.
Please
Give me a tips Or setting or changes to increase milage of my TVS Star City-ES 100 CC bike.

Waiting for your reply,
Regards,
Viju.
srinivas on February 3, 2010 at 5:53 pm

hi! iam new to this but i heard ur tips & suggestions are good.
i would like to take a new bike but i am having some confusion, can u help me. my frnds are suggesting me to take rtr-160, pulsar 180. but i heard that for apache vibrations are more.
My requirement is a good loking bike , which gives a mileage of 40 or above , and reuire less maintenance…….
jaroos on February 3, 2010 at 8:10 pm

hi srinivas! honda gives more mileage, power and less maintenance. y cant u try honda? . rtr160 is a good bike…. you will get true value for your money….! the engine of pulsar and apache is not as refined as the honda and yamaha company. I am not telling its bad . rtr160 is much better than pulsar180.

<>
jaroos on February 3, 2010 at 8:19 pm

MILEAGE TIPS -Tyres, air pressure, spark plug, carbrtr, speed etc makes a signfcnt change in the mileage of the vechicle!
drive between 40 and 60 . use good fuel and oils . clean ur carbrtrs,filters frequently. USE ONLY ORIGNL PARTS. the air pressure of the tyres shud me maintained well. perfect gear shifts , smooth drivng .–these steps will definitly increase ur mileage..!-jaroos!
jaroos on February 3, 2010 at 8:44 pm

MY EXPERIENCE…

MY name is SOORAJ.M.S. ( called as JAROOS). I am from Thrissur Kerala. I am very crazy about bikes . I have used almost every brand of bikes now in market . So i would like to share few things with you people.

Always buy trusted brands.(honda, yamaha etc)

Power is inversely proportional to mileage and so power bikes delivers less mileage.

Never buy an old bike even if you get it cheap .(pls check the engine efficiency before buying)

Always maintain you vechicle properly with proper servicing.
maven on February 5, 2010 at 6:52 pm

i hv a honda dio, its milleage is very poor.. i like to race. now my dio reaches 100 speed with full acceleration.. before it was just 90-93.. but wen i ride it even at 50 speed its result is very poor. it just gives me around 28kmpl in city & on highways it reaches around 32kmpl.. Hey guys plz do help me wit dis… plz reply me regardin dis on my emil id,
my email id is,
mavens28@yahoo.com
sunny on February 5, 2010 at 7:29 pm

sir which is best bike in fazer and 220 in mileage, looks
Vinay Prasad on February 9, 2010 at 2:17 pm

Hi, I have pulsar 150 with Rear MRF ZAPPER Q TYRE, can you tell me the what is the mileage should of my bike? i will waiting for reply
Srinivas.. on February 9, 2010 at 11:56 pm

Hi…. Vinay…

Which byke r u Having…??

Is it Dts-i…??? model…???

2002-2004…???

2005-06…???

2007..to till now…??? Dont expect more mileage from the Models starting form 2007…it will be utmost 45-49…

Hi…. srinivas(Feb3)…

comparing Pulsar180 and apache RTR160…

Pulsar is the best pick…..

TVS never gives the value for money….

Closely observe right starting from kick starter rubber to everything… all are of cheap quality compared to Pulsar(Dont compare with Honda or Herohonda…)

Ask anyone even if you drive rashly pulsar is more controllable than Apache…(My personal experience and also most of my friends having Apache Too..)

Also Apache gets more repairs than Pulsar(Mechanics opinion)..

Apche 160 & Pulasr180 has got similar milage…

Power of Pulsar 180 is incredible 17ps…(More than Apache160 but RTR 180 has got same power)…

Dont think that i’m praising Pulsar… it has too its limitations.. Like detatchable stickers.. poor clutch plates(Apache too..)…etc….

So the final Decision is up to u..

Hi Jaroos…..

Honda got refined engine than Bajaj’s and TVS… u r right…

But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. Dont think that i’m underestimating Honda bikes they are good enough.. i agree… But..

____Too much servicing cost…

____spare parts cost are Horrible…

____servicing should not be done by normal mechanics….
Srinivas.. on February 10, 2010 at 12:14 am

Hi… Srinivas(Feb3)…

I forget to tell about the Vibrations of Apache its True and fact in rising speed around 70 or so… IT IS AGREED ITSELF BY THE TVS company……

its true Dude… go for a trial if u dont believe…

My friends also reported the same problem….

DO U KNOW THE PROBLEM CONTINUED WITH RTR180 ALSO…

Its A Sad drawback for RTR loverz…
Vinay Prasad on February 10, 2010 at 9:54 am

Hi,
I have Pulsar 150 (Not Dtsi)2004 March Model. I have used MRF ZAPPER Q REAR TYRE, i have used Castrol Engine oil after 2500 km. can you tell me what is the right milegar of this model, and if i used normal pertol (not extra primium) so any proble with that?
Vishal on February 10, 2010 at 7:02 pm

Hi..!
I have HONDA CBF Stunner. It’s nice bike it gives me 45-50 kmpl.
Can u plz tell me how to check @ whether engine oil needs to be changed..

Thanks
Vishal
Srinivas.. on February 10, 2010 at 10:37 pm

Hi….Vishal….

Dts-i models give more mileage than previous versions…

u can expect a decent mileage of above 40-45 if u ride decently with good carburettor settings…

Adjust carburettor idle settings to 1 (rpm*1000)…

ride between 40-45 not exceeding 3 rpm*1000(or slightly above 3) for every gear.. lower gears can be operated below 3….. it will give you mind blowing mileage.. try this…..

u r using the engine oil for longer distances it is not right(2500)…. try to change the engine oil every 1700-1800 kms or below… it will be good… if u love ur bike and want to keep it young u can change the oil below 1700kms by checking it… it helps engine remain young.. keep it in mind.. dont think for 200rs… use castrol active4T…

Use only Normal unleaded Petrol from a good bunk…
Prefarably 1st.. Bharat petr.. 2nd.. Hindustan petr.. Gives u best results .. i can bet for this with any one….. But dont use SPEED.. it will alters the performance and effects the life of engine and silencer… the same with Extra premium… i can bet for that also…

Also try to avoid petrol in IBP and others…

Post ur comment….

Hi… Vishal…..

see this post i have given Kms for changing oil.. but go for the preferred oil for stunner..

For checking the oil remove the oil cap use cutting pliers….. take a clean cloth and wipe the level strip.. and insert into engine that means dip one time and take out and observe it… and touch with ur clean finger…

it it is some what black or black.. then immediately it should be changed…

also if it is down the level of strip it should be changed…

by touching oil if u r having a gritty feeling or having heavier feeling.. then it is time to change it….
Srinivas.. on February 10, 2010 at 10:48 pm

Hey vishal…

Ive forget that for checking engine oil the bike should be in centre stand…. and bike shoulnot be in overrunned condition…(i.e checking after a long drive)…gives wrong results….. check the oil during hault condition
jaroos on February 10, 2010 at 11:23 pm

hiii frndz….!

Its true that apache vibrates after 70 . When we compare with pulsar dfntltly te pulsr dominatz. The quality of the parts are low but if offers more features… tatz y appache got te captn ‘value for money’. It looses its grip fastly….!!!!!
1. Digital Speedometer.
2. Petal shaped disc brakes.
3. Serrated design stickers.
4. Naked chain cover.
5. LED tail lamps.
6. Clip on handlebar for various positions.
7. Service and battery indicator.
8. The digital display has a feature to test the top speed achieved.
9. You can also test your 0-60km/h timing on the digital display.
10. Tank cowl like in the Bajaj Pulsar 220.

THESE FEATURES ARE THE ATTRACTIONS OF APPACHE. the Apache RTR 160 has been upgraded with electronic fuel injection(EFI) and becomes Apache RTR 160 Fi. Is ter any othr bike which givz tez many facilities???? I KNOW THAT THE QUALITY IS LESS . But still it offers many features and tatz te reason for te captn ‘value for money’ hop its clear! wen v compare te same catgry of bikes v can c tat appche offers more facilities even though the qualty is less…..Its just my opinion….! pulsr offers more pwr and stblty than rtr.
jaroos on February 10, 2010 at 11:37 pm

THE SEVICING COST OF HONDA IS HIGH BCAUSE IT OFFERZ QUALITY PARTZ. THE CHANCES FOR DAMAGE IS VERY LESS,ENGINE IS VERY MUCH REFINED,COMPLAITS ARE VERY LESS, HONDA OFFERS GOOD AND PROMPT SERVICING.

_THE PRICES OF SPARE PARTS ARE HIGH… BUT THE CHANCES FOR DAMAGE IS VERY LESS…. A HIGH PRICED QUALITY PRDUCT IS MUCH BETTER TAN LOW PRICD ORDNRY PRDCT….

SEVICING DONE BY TE XPERTZ OF HONDA IS BETTR THAN TE SERVICE PROVIDED BY TE LOCAL MECHANIC….!

I CANT UNDERSTAND WHTZ TE PROBLM WITH TE HONDA BRAND…!!!!!
HONDA OFFERS THE SMOOTEST ENGINE…..!
IT OFFERS GOOD FEEL TOO….

-JAROOS
jaroos on February 10, 2010 at 11:44 pm

XCUSE ME …..

I read ur comment and i hav a small doubt regarding ur post….

”But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ”

please make it clear. what r u trying to say?
r u tellng about the pick up ?
please describe ur problems that u hav noticed….
Nirmal on February 12, 2010 at 8:00 am

hi i’m Nirmal.. i own bajaj XCD 125cc and my mileage is 40-50!!
Srinivas... on February 13, 2010 at 4:36 pm

Hi… Jaroos dude….

U only agreed that Pulsar offers more stability than Apache… Thats enough..

Coming to its Fi… Its only a technological upgrade dude.. not useful to u or me or any indian.. it requires highly efficient Professionals (not normal showroom mechanics)to monitor.. and its highly sensitive and cost effective and cant be monitored within 1hour or so like that of a normal carburettor..

Also main thing is COST… Do u know what made the Bajaj to quit the Fuel injection tech of P220 and come back to normal traditional carburettor its the above terms.. and also normal carburettor can be handled by even U and me man.. i think u got the point.. I’m not hating FI dude.. im only stating the fact…

Also u have stated the facilities offered by RTR these r good but these gives no significance to people… they go after seeing the total outcome… Hey dont conclude im hater of RTR… it is a good one…

coming to HONDA concept….

Hey Dude i agreed na that HONDA bikes are good…

But coming to cost effectiveness and servicing charges and spare parts these occupy a least share in market.. thats it…

I can give u classic example…

Take Unicorn & Pulsar(or)Apache.. if both the bikes fell and parts are damaged.. By paying the bucks towards Unicorn our pocket will be torn out when compared with Pulsar(or)Apache…. its just an example…

The average indian or student or job worker thinks above fact and opts for the other 150cc bikes…

According to my opinion and lots of my friends opinion and as an Average INDIAN the people when buying anew 150cc bike they think of

Pulsar—-
optimized for rash and fast driving with certain limits.. good for looks.. power… pick up.. spare parts cost is low.. technologicaly an upgradedone (but previous versions 2005-06 are best versions of pulsar..not my opinion.. its the servicemen opinion)…….Major Drawback.. NO RE-SALE VALUE…

CBZ-xtreme—-
An outstanding bike in the whole 150cc segment…
No need to Describe a Herohonda bike.. Right from starting Cd100(My favourite in those days) till ZMR these bikes rock the market.. IN KEEPING VIEW OF COST(These have more costlier than Bajaj)..But worlds numberone…1…!
If u want an xtreme in Hyd u want to book two months before.. thats the craze ….AND ALSO MINUS OF IT…. MY FRIEnd waited & waited & waited for it and went for Pulsar200
But HH Definitely Good than Bajaj And TVS…

Apache—
U described about it dude… No need of me..

Unicorn—–
Purely a masterpiece..
These ones are for those who die for quality..
No need to think for taking it..
If U HAVE A LOT OF MONEY..
i will justify my Prevoius comment below….

Yamaha–
Takes time for analysing because these are new to market.. for more power these bikes r ultimate.. R15 is enough.. no words to decribe it…Its just afterall 150cc bike but has ability to race with P220…
Also yamaha offers good quality…

Suzuki…
legend once before… samurai.. shogun…etc..
Gs150r has no looks sorry to say…. also same with other suzuki bikes.. less service centres…. the company has to wakeup…

MY COMMENT…
”But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ””But mainly it lags The feeling of riding a bike that too a big bike… it is almost similar to riding that of a battery bikes.. ”

dude.. its the feeling man that the bike will give to u…
i will make u understand…

For example…
Take Dio or Activa.. go for a ride.. Plz think that they have gears and u r riding them(Im telling this i have no other example for a 100cc in honda).. ok….
Now go for a ride on HH Passion plus(i can tell an example in bajaj but those are not refined as HH or honda)…ok…

Both bikes are slightly similar in power and other terms…
Now what is your feeling..???
Honda is refined …k… i agree…
what made u feel apart from that.. the feeling the bike gave to u… UNICORN lags that when compared to Pulsar or X-treme or APache.. i think u have understood that..

Purely saying Unicorn a NUMB bike…. The More Refinement or other thing it gave the numbness.. it is good for those who want it.. CARS mainly Have the NUMBNESS………

But not for COLLEGE GUYS.. and common man… and bike enthusiasts..

Hey.. Dont think that im degrading Unicorn.. i’ve already said that it is a Master piece.. Also I LOVE UNICORN(NOT THE OLDER VERSION)…

cheers dude… Post ur comment…..
ranadheer on February 14, 2010 at 4:22 pm

hi i am having a karizma r 2007 model , but it gives a very low mileage of 30 to 35 and also the top speed is 110kmph. i would be happy if u give some advice to improve my bikes performance and mileage. thank you
.::_maniac on February 18, 2010 at 7:06 pm

I have two bikes…

A Hero honda Splender..It gives about 55-65 in ordinary petrol and 70-75 in special petrol(eg:Speed).
Regular speed 60km/hr
And a TVS Heavy duty give about 85- 90
top speed 50-55
regular speed 40km/hr
Ehatesham-Hafiz on February 20, 2010 at 7:49 am

i have karizma …the first edition when d bike was launched..the model is 2003…from the start day it gives me an average of 35..at all speed…as i participate in races n al usin d bik …there has been no change in the average til now from the day i purchased d bike…also i hav done some modifications to d bike which boosts my bike giving a top speed of 200kmph…which is a very top speed….i would like to suggest a tip…. when d bike is new…don drive more than 40kmph..upto the 1st service…doin so not only increases d performance but also gives longer life to it…n 1 more secret..u can adjust d pickup of d bike..when nt in use u can reduce d pickup..which saves lot f fuel..
chetan on February 22, 2010 at 12:51 pm

hello sir…..i am a tremendous fan of pulsar and i own a p200..well my question for you is now my bike is 2 yrs old and it gives me a top speed of 121 kmph(single rider)
..i want to ask you should i go for K&N R1100(with jetting)and change of sprockets(smaller one may be 36-37 teeths).well right now i am looking for speed both pick up and top speed ….plz help
Dante on February 23, 2010 at 10:36 am

Which bike is better Fazer (new model) or Pulsar 220? (In performance, looks, speed, maintainance, mileage)
bikeluver on February 23, 2010 at 4:52 pm

i have a new pulser 150dtsi..i brought it 6 month before..how can i figure out millage pre lit… plz suggest…
bikeluver on February 23, 2010 at 4:59 pm

i use speed(petrol)…is it harmful???which petrol is good for my bike???
Ehatesham-Hafiz on February 23, 2010 at 9:31 pm

go 2 sum mechanic…dey hav an smal container f bout 1 litre…fil petrol in tat…check ur odometre…n c how much far it goes in 1 litre f fuel…for eg: it travels 15kms…den ur average wil b 15…
Ehatesham-Hafiz on February 23, 2010 at 9:35 pm

usin speed petrol n al is f no use…if u hav an feelin tat it adds sum pik up or so…do 1 thin…only once u fil speed petrol frm nxt tym u can fil any petrol …as d speed petrol wil mix up d othr tym u fil….d best fuel i recommend u is unleaded fuel….
Ehatesham-Hafiz on February 23, 2010 at 9:37 pm

p220…is far much better than fazer..
Yusuf on February 26, 2010 at 3:26 pm

Hi brother.. i have CBZ X TREME.. 11/2007(BLACK) model and mileage is 40-45 in city.. and while im riding i feel engine is not smooth.. its a bit harsh, which irritates me always..

1. How can i get more mileage ..

2. How the engine will be smooth.
Naved on February 26, 2010 at 3:36 pm

Hi,
My name is naved. I have a Honda unicorn 150cc model 2006, it gives me average mileage between 33 to 35 kmpl, how can i get more mileage from it now?.
Aditya on February 26, 2010 at 7:43 pm

Honda Activa :- 47 during normal driving conditions…
around 42 during 60-70 kmph …done (31000kms,late 2006 purchase)
Mukund @ Nainital on February 27, 2010 at 8:19 pm

Can anyone tell me what is the mileage like for Suzuki GS150R for the period before the 1st Service while driving in a hilly terrain???
asif on February 28, 2010 at 10:38 am

hey guys,i need to know if put up a sound makin air filter in ma bike…is it gonna reduce the mileage?…….
MAX on March 1, 2010 at 7:58 pm

I have a RTR Fi for about a yr now n shd say tat i haven’t seen a better bike…It gives me around 45-50km/ltr…and wat is this nonsense about it vibrating at 70kmph???I have done a steady 131kmph on it n the bike is ROCK STEADY…
Deep on March 4, 2010 at 4:24 pm

Honda unicorn 2009 model with a mileage of 55km/ltr overall
Deep on March 4, 2010 at 4:26 pm

hi my honda unicorn 2009 model gives me an overall mileage of 55 kms / ltr . is it a good one?
Dante on March 5, 2010 at 8:51 am

which type of petrol shall i use in fazer and kawaski ninja
Mahavir Kothari on March 5, 2010 at 11:43 am

Hi to all the persons who left there comments.

Basically You have to follow some tip for making your bike fuel efficient

1. Check the tyre pressure regularly.

2. Service and oil change as suggested by the company’s parameter

3. Some bikes come with manufacturing defects that will not be known untill the first service of bike so list down all the problems and get it solved at the time of fist service

4. Don’t ride at a constant speed always make some 5-10 KMPH variation while accelerating.

5. Try to ride the bike in 40-60 KMPH range.

6. Don’t Change gear frequently if not needed.

7. Don’t use brake unneccesarly.

8. If the engine is used in cold condition then give 30 seconds to 1 minute to hot up the engine.

9. When you change your bike’s chain. Change the enitre set which include front and rear sprocket.

10. Make sure your carburetor is tuned otherwise you will not get proper mileage.

Thanks,

Mahavir
Harsha.. on March 5, 2010 at 6:34 pm

Hi friends
I’ve Yamaha Gladiator Type RS
2009 model
I’m currently getting a pretty decent mileage of around 60-63kmpl in City (Ofcousre the road that i ride in will always be clear)..:-)
I ride between 45-50kmph..
I never rev it hard..
I do maintain it as clean as possible..
It has done around 2.5k kms till now..
2 free services have got over
rohit on March 9, 2010 at 6:39 pm

hi i m rohit.I have hero honda glamour.its average is approx 45.i want to know how to use gear mechanism and clutch for max average in both city n highway.
JINA on March 10, 2010 at 11:51 am

HI, AM A NEW SUBSCRIBER, N AM REALLY GLAD TO FIND SUCH A SITE WHICH HAS GOT INFO ON INDIAN BIKES, THIS IS REALLY A VERY GUD EFFORT BY U GUYS.. KEEP IT UP…

Am having 180cc pulsar, am gettn a average mileage of 45-47 Km
I ride a little rash,(upto 70kms/hr). I get it serviced with the authorised dealers as per the shcedule.

My prob is dat der is a noise coming from my engine when i maintain a speed of 60km but when i throttle it to 70 there is no noise!! is this the problem with Timing belt adjustment??

Nowadays i feel like am losing balance in my bike, i think dat my bike is not moving straight, it’s pulling me to other side, is it due to bend in the alloy wheel(6 spokes)? Shud i change my Rim of both the tires to overcome this problem.
bhanuteja on March 12, 2010 at 1:14 am

hello,

I have got a brand new Yamaha Fazer 153 cc,
what driving speed before first service you suggest would be best for better mileage.

thanks
bhanuteja
Aniket on March 18, 2010 at 7:53 am

Namaste,

I am facing a lot of milage problem with my pulsar 150cc (2008 model)which use to give 50-55 km /ltr before, but now withing city it is giving 25-30 km / ltr!!
last time when i complained to bajaj service centre, they checked the milage with 100ml of petrol which showed 5km !! that is 50km milage but when i checked my self again it is providing 25-30 km / ltr!! how to fix this problem? is there any way that i can get good milage again? kindly guide me. thanks
Kathir on March 23, 2010 at 8:26 pm

Hi,
I own Yamaha Gladiator type SS, its almost one year now. Initially I got a good mileage of 60 to 65 KMS/liter, after a hills ride the mileage has gone down to 50 KMS/ liter.
I have not done any changes to the bike, and I drive at the same speed, on average 40 – 50 KMPH.
Can you please help me.

Thanks in advance.
Anirudh on March 25, 2010 at 9:51 pm

Hi. You have told to remove the saree gaurd. But incase of its needed what would be the problem? Pls post the answer for it
rohit on March 29, 2010 at 12:55 am

hi..
i have a star city 2007 model.it is giving an average of about40-45 km in city.i have got a engine cover as well as a modified silencer in my bike.so i want some tips to improve the average of my bike.
sir you are kindly requested to give me some valuable tips so that i can improve my bike average.
thanks a lot.
ruchika on April 5, 2010 at 9:40 pm

hi i have a kinetic honda 1998 model.
how can i improve it’s mileage bcoz i am not ready to have a new vehicle.
Gunawan_Indonesia on April 9, 2010 at 9:39 am

Hi everyone, i’m Gunawan from Indonesia. I own and use Bajaj Pulsar 200 DTSi, and from my experience, the fuel consumption goes like this:

1. City/Urban riding: Worst 38 KPL, Best 45 KPL (Jakarta has one of the shittiest traffic condition among capital cities of the world)
2. Highway/Rural riding: Worst 46 KPL, Best 56 KPL (best case achieved in a long, straight, flat highway on the north coastal road of Java island)

My bike has run around 12 thousand KM, and in a pretty good condition. It only runs on standard, 88 RON gasoline, yet the fuel efficiency seems good, even compared when i tried using the premium, 92 RON gasoline, doesn’t show much if any improvement at all.

Regards.
Deepak on April 14, 2010 at 8:13 am

Hi ,

I have yamaha fz.My office is just nearby therefore Every day I travel only 5 km.

My bike’s average is 30-35km/hr.I want to increase my bike’s average.

Total km :1200Km
Please advise.
naveen on April 17, 2010 at 11:02 am

hi,
i am having hero honda passion plus bike and it is giving 40 per liter mileage only in city how can i increase the mileage pls send me the solution pls

send me the solution to my id naveen_nani1986@yahoo.com

thanx in advance
lalit gupta on April 24, 2010 at 12:21 am

i have yamaha fazer 153cc how can i increase my bike performance
and mileage
Arka on April 25, 2010 at 2:46 pm

I am having FZ 16 .it is giving 35 km per liter.how can i increase the mileage
vipindev on April 30, 2010 at 11:46 am

hi…i have the LATEST BIKE HONDA BB twister its cool and have some milage around 57 or 58 in off road……..the company says 70 and some people gets 71 why such a differance occure
Vishal Sharma on May 4, 2010 at 7:55 am

I own Hero Honda Hunk 2007 Model, You all will be surprised to know that it gives me average of 61 on highway and 55 in the city..very pleased with its performance..
rakesh on May 5, 2010 at 9:10 pm

my bike is glomour it gives only 40kms/lit wat i can do.
C.K.POOVAIAH on May 7, 2010 at 8:58 am

I HAVE A H.H.CBZ,2000,BLUE. I’M GETTING AN AVERAGE MILAGE OF 50KMPL. ON HIGH WAYS I GET AROUND 54KMPL . I HAVE GOT KARIZMA ALLOY WHEELS FIXED IN IT. I MAINTAIN A AVERAGE SPEED OS 40-50KMPH IN CITY AND ON HIGHWAYS AN AVG OF 70-80KMPH. ENGINE OIL I USE IS CASTROL ACTIVE 4T. I CHANGE ENGINE OIL FOR EVERY 2.0K TO 2.3K. GIVE ME MORE GOOD SUGGESTIONS TO MAINTAIN A GOOD HEALTH OF MY BIKE.
shiva on May 8, 2010 at 11:03 am

hi mamam plz let me knows abi shine bike to change it to sport look
Madhur Goyal on May 12, 2010 at 4:41 pm

Anil,
Hey buddy you mentioned above that “leave your engine start for 10-15 seconds.” So I want to know, that I have to give any acceleration during this 10-15 seconds or leave the Bike as it is..
Shrinivas on May 12, 2010 at 5:37 pm

hey deepak,

thanx for this all valuable info.
let’s would you please tell me that i have passion PRO
i have ride it 50 to 55 KMPH when it was new so is it any problem if any how can it be solve currently it is giving 55 to 60 KM/ltr avrage what can i do so that the avareg can increase
Muthuklumar on May 13, 2010 at 7:19 pm

I have a suzuki max 100R it gives me 35 in the city and 40 on the highway.how can i take more mileage now?
Majid on May 17, 2010 at 5:50 am

I have a Suziki fiero which gives me 80 milege in highway and 70 in city…I am very satisfied with this…
shri on May 25, 2010 at 12:25 pm

hi frnz….tis s shri from coimbatore….happy 2 say i own a new plsar 220…well i luvd it i got it on may 10 ..but am not happy wit my mileage…i get 30 now…wil i get atleast above 37-40????pls can u suggest me for it??? i do drive within 40-60 inside city nd somtimes 80-110 due to some emergency….nd pls help me to do better….am mad ff ma bike…nd i don wan to leve tat hope…help me..solute me to my id…..pls
varun on May 26, 2010 at 4:43 pm

hi frndz…
i m plannig 2 buy a karizma.ma drivin s nt bad.
wt milage can i expect 4 it??i have drive arnd 30 kms daily
any other bike u suggest??
Vijay Srinivas on May 27, 2010 at 2:01 pm

I have a Honda Activa, which I bought 1 & 1/2 years ago. Initially, I was getting a mileage of 35, since I didnt know how to drive properly. Then it had increased, and reached upto 55 km per liter after fourth servicing (I use Shell Petrol).
But of late, the mileage has been dropping to about 47-48 km per liter, though I take particular care about mileage as far as possible. Other external factors are there that cannot be avoided as listed below:
1. Traffic Jams, these cannot be avoided, but I try to avoid areas like M. G. Road, Majestic & Kalasipalya in Bangalore (synonymous to areas like Chandni Chowk, Connaught Place, Karol Bagh, South Extension, AIIMS & Patel Nagar in Delhi) as far as possible (travel to these places only rarely using scooter). But generally, they can occur anywhere within the city.
2. Cant avoid bad roads as well, especially if it is a routine route. If it is some route that I try to explore, and come across a bad road, then I dont take that road at all for the next six months, and this continues till that roads gets rectified.
3. Although I try avoiding sudden braking, but some clumsy autowallahs and tempos come from nowhere suddenly, and have to use them also occasionally.

I feel that the back wheel is not rotating smooth, and there is a drag when I pick up speed.
Could anybody suggest what could be the problem with the resistance of the back wheel, and is it customary to have resistance or not? If there is a problem, is it the bearing problem, or the belt problem, or the piston problem?
rajesh on May 28, 2010 at 4:43 pm

hi…….
Am rajesh.
I have fz16 me want to improve my milage my bike milage is just 30 how can i improve it
vigora dhiraj m on June 2, 2010 at 5:09 pm

dear sir ,
my new 3 month old honda shine 45km/lit average give on high-way my average speed only 45 km/hr .please give me some suggestion for better millage

regards
dhiraj vigora
m-09228227983
dev on June 5, 2010 at 2:09 pm

Hi, i have apachertr160fi and it’s milage is about 40 which is not satisfactory so i like to increase my bike’s milage pls help me
siva on June 9, 2010 at 4:16 pm

my bike is hunk and my mileage is 35-40kmpl……mostly it gives 35…..i drive at a speed of 60.and i want to increase my mileage to 50-55 what should i do
shoaib on June 14, 2010 at 6:49 pm

hi i am new to this place. well i have a problem with my bike. i own a hero honda hunk 2009 model. well 8 months the bike works great but when its monsoon season and when it rains my bike starts but after a few seconds it shuts down. again it starts and shut down. can u plzz give me a salution to the problem as i keep my bike in good condition. i change the oil in every 1.5 months and give it for servicing every month. plzzz help me.
Vishal on June 15, 2010 at 8:24 am

Well Shoaid – The same problem was with my hunk as well but i got it resolved. What u all need to do is to shorten the length of a pipe that is out there to throw out the water or dust from petrol tank. The location of the pipe is between the rear of silencer & rear tyre…it will be just hanging out there near rear mud guard…can be identified easily..lemme know if you get it done. Otherwise, u can take it to the mechanic & tell him the problem..
amit on June 15, 2010 at 2:11 pm

hi , i have a karizma2007. i am sick of my bike mileage, it gives only 26km/l. please tell me for improving the mileage. or tell me either we change the karizma engine. means can we fit the splender engine to karizma for improving mileage, i am not worry about speed and pickup after doing this.
Ibrahimsha on June 16, 2010 at 7:20 am

Hi,everyone..,i have an Yamaha Enticer(2003) model.,it gives a mileage of 38/lit.,I read the description of that vehicle in a website.,its written, it gives a mileage of best case:62/lit & a worst case:55/lit.,My question is that how can i increase the mileage of my vehicle…,Any1 plz help me…
Venu on June 18, 2010 at 10:49 am

Hi,

I am using Apache RTR 160cc. Please provide your valuable suggestions for getting good mileage.Presently my bike is not giving more than 40Kms/Lit
shoaib on June 18, 2010 at 12:40 pm

@ Vishal well can u be more pricise with the pipe and wht may be the problem. plzzz reply man. i really need ur help. those jackasses in the HH service center took my bike for 3 days and could not find a solution. so plzzzzzz man helpp me really. waiting for ur reply. or just give me ur cell no i will give u a call if thts ok with u.
shoaib on June 18, 2010 at 5:27 pm

@ Venu well man apache rtr 160cc is ment for speed man. so tht means less mileage. but if u do not go above 50 kmph and dont wont much pic up then try to reduce the picup and put a small fuel pump. hope it helps u lol
krishna on June 18, 2010 at 8:33 pm

im having apache rtr160 and it is giving a mileage of 38-40 so im not satisfaction with this so pl can u help me how can i increase my mileage
sanju on July 1, 2010 at 9:16 pm

i have bajaj discover i like to travel
my has crosee 2 lakh kilometer . i had my bike 4 year back . it had been travel 6ookm at a day . till today i never had a problem to m bike . now i have modifed my bike which has been done by me . i want to post the pic of my bike i want ur comments on it ? how can i ? and is this desigen can go futher ?
Aj on July 2, 2010 at 3:02 pm

Hey friends i got an apache160 two weeks back i filled 10litres of petrol and rode oly 280km in two weeks and it dried….. That gives me a mileage of 28kmpl…. So sad company claims that it gives 50and i don drive it fast too….. Max i’ve reached is 58and the service personal rode it and ripped my baby to 86 …. I dono what’s wrong wit it and performance is good but it’s mileage worries me…. Can u give any tips…. I’m waitin for ur replies
Himanshu on July 2, 2010 at 3:18 pm

Dear all,,

I am Himanshu Bhardwaj from delhi, I am having a Karizma bike from last two years. From the day i am taking care of the things which a bike needed.. Like first thousand kilometeres i run my bike at a 40 to 50 Km.ph Speed. I used to change every part of my bike when it get weared the parts are genuine. Earlier it was giving an average of 40 in the city. But now after running 35000 KM. My bike is giving a milage of 32+ but why it is so after all i am doing all necessary thing to my bike. Please suggest me what else i a can do.
sunilsandy on July 3, 2010 at 11:52 am

hi sir i ha an rx 100 bike the modle is 1988 it gives me jst 25 mileage d bike is fully stock and my friends rx 100 gives him 36 mileage his bike is fully poted so can u tell me tips to increase my bike mileage plz……
binni on July 5, 2010 at 9:32 pm

hi friend.i have 2002 apr. model rxz bike and it cross 100000km still its gives me 45+ milege.and it goes up to 132kmph.so from my view its enough for my motor.what u say friend
Shreyas on July 6, 2010 at 7:16 pm

my bike is splendor+ of 2008 mdel,i have driven 12000 kms,but am not happy of my mileage,its giving around58-62.Am driving below 50speed,please suggest me
kiran on July 6, 2010 at 8:46 pm

hello,
i am kiran, i have hero honda super splender, when it was new it gave around 50-55 mileage, max 50, for 4 years it gave 50, but after we gave it in hero honda showroom for service, it started giving 40,and slowly decreasing to 36,earlier we gave it in other service center. pls advice me, what to do.
Mayank Goyal on July 7, 2010 at 2:48 pm

Hi
Good to read this article. I have Bajaj Wind125 June2004 model. I have completed around 96,000 Km so far. . My bike was giving a mileage of around 50 nut now a days this has gone worst it is giving 30-33.My mechanic says he needs to change the carburettor to increase the mileage. Please suggest me what to do…
Gaurang Patel on July 7, 2010 at 4:08 pm

Hi All,
It’s Good information for who want to purchase new bike,
well i have Honda CBF Stunner old Version, Purchased jun-2009.
My bike giving me 55-60 km/liter in City and 63km on highway.
I maintain my bike well not riding above 50 Km/h and changing Engine oil after every 2500 Km and check Air preassure as 33 in front and 37 in Rear Tyer.
Please do not take pickup of your bike immidiately it will damage your block piston and burn more fuel, ultimately it will effect on your fuel efficiency and riding pleaseure.

Thanking you,
Gaurang Patel
Vadodara.
Vimal on July 16, 2010 at 6:05 pm

I ve an Rx-135 4 speed 1999 Model. Fitted with Expansion chamber and 2 times rebored the cylinder. I get a Mileage of 40 in rash driving(Above 100 kmph) and near to 45 in normal riding. And I get a pretty gud top speed of 120-125 kmph.
Abhi on July 18, 2010 at 1:47 pm

Hii Brother. .i’m Abhi i reside in Mangalore.I have A 1995 Model RX-100 whch gives around 24 mileage per litre.I asked a local mechanic on the mileage problem, he said changing the Carburetor Mite work it for you.Can you help me with this Problem ? Is ther anythng I could do fr Getting A higher Mileage. Plz Help Me. !!
Bikram on July 22, 2010 at 10:40 am

hi all
i have a bajaj pulsar 220 fi,it gives me the milage around 30km/ltr.is it ok.can I expect some more milage from it??????
siva on July 24, 2010 at 9:29 am

My pulsar150 2010 model is returning me 60 km/l given that my office ride is along a neat traffic less road. I take no special care maintaining my bike, but change oil perfectly. Also petrol bunk is un changed, it is the most trust-able bunk in my town. I hit 5th gear in 34 kmph speed, slowly gets it to 40-45, keep it there. Not just that, my ride is 30% city drive also, where heavy traffic, countless breaks need to apply. So over all combining the two, 60 is a good figure
Sadiq on July 25, 2010 at 10:13 pm

Hi folks. I am from Chennai and i got my cbz-x sports red colour bike just a week ago. I already covered 550 km so far since i travel 100 km to and fro between home and office. This is my first bike and i am really happy to have this bike. With the bike still due for its first service i am getting a mileage of 58-60 km on an average. My daily commute includes 70% on highway and the rest in city traffic and i drive at an average 50 kmph. The only problem i am facing right now is with the gearbox. Its pretty stiff and hard. Even getting occasional gear jam. This is very annoying especially when i am stuck in the middle of heavy traffic. Before getting the bike i read in the reviews that cbz x has one of the smoothest gear boxes. But this is not the case with mine. Can anyone please suggest how this can be fixed.
Anand on July 27, 2010 at 11:01 am

Hi,
This is anand here from Chennai.3 month back i purchased FZ 16 black colour. Showroom people promised a mileage of 45 Km / Litre in city. But i am not getting that mileage now. Before 1st service mileage was around 40 Km/L in city and now 2 services are already gone and i am getting only 30 Kms/L and not more than that. Can any one help me out ? wat can be done here? going back to service centre is the only option or any other remedies???
Sadiq on July 27, 2010 at 1:16 pm

Dear fellow bikers,

One more point to add to my last comment. I am getting frequent gear locks during sudden deceleration from an higher gear. At times of hard braking, i am unable to shift to lower gears unless i stop the bike and move it a little backwards. I checked with the service center guy and he informed me that this usually happens with all bikes. Is this true?.

Please advice.
laxmikanth venkatraman on July 28, 2010 at 10:09 pm

sadiq..
am not sure about HH CBZ xtreme, cos i never took a ride on it and to be frank to u i dont like.
i own pulsar 150 UG 4.5 the latest one. though pulsars are famous for its gear problem, i also faced the same issue u mentioned. but try to reduce ur gear when u are almost to hault ur bike to 0kmph from 10 kmph, while u drop down to whatever speed u were. u cant just stop to nil movement as that will skid and u r on the ground with ur bike. hence i consider ur hard braking is to sudden slow down. so when ur speedo needle dropping near to 10kmph try reducing ur gear very fast..
krishan on July 31, 2010 at 6:12 pm

i have honda activa
make year:2009
has one 2700 km
advice how to improve mileage of my vehicle i drive it in city only
karthik on August 1, 2010 at 11:09 pm

does holdin d clutch durin slopes causes any excess flow of fuel???? plz reply !!!
Rajasekar on August 5, 2010 at 1:27 pm

Hi,
I bought the Honda CB Shine on June 2010. First service is over and now am facing the problem Gear struk up while changing 3-rd to 4-th (Vice Versa) and mileage is very poor. it gives only 40 km/lit. Daily am travelling at least 38 – 40 km. Please help me this.

Am also from Tamilnadu only.
sandeep rao on August 6, 2010 at 7:40 am

i do have herohonda passion plus(2009 dec) which gives me mileage of 62-67 kmpl…..
Amit Patel on August 23, 2010 at 6:19 pm

Hi,

My Pulsar 150 2007 model. Can any find out the milage I am running my evryday from Monday to Friday 35 Km a day and every monday I fillup my tank for Rs. 200/-
My email amitpatls@rediffmail.com
Kaustubh on August 25, 2010 at 7:09 pm

Bajaj XCD 125 dts-si
city-70 kmpl
my avg speed-45 km/h

is the mileage good enough?
Subroto Bhattacharjee on August 25, 2010 at 7:38 pm

Hi Kaustubh,

It is something around 50. This is the good mileage for Pulsar 150.

Mine is giving 50-55.
Manoj on August 26, 2010 at 5:17 pm

I have Honda Unicorn 150 CC with Mac wheel model. i getting only 35 to 40 average in 1 litter. as per suggestion of my mechanic i have changed my bike piston and valve but still i getting same average. please tell how can i improve my bike mileage and tell me the corroborate air screw setting.

waiting for your reply

regards
Manoj
Dharamvir Deshwal on August 31, 2010 at 10:05 am

dear, mere pass TVS apache RTR 160 h iski average52 h

Tips for Improving Your Bike’s Mileage

Leave a comment

Search Bike Models & Reviews

FB Fan Page

Sponsors

Recent Posts

Archives

Categories

Tips for Improving Your Bike’s Mileage

Leave a comment

Search Bike Models & Reviews

FB Fan Page

Sponsors

Recent Posts

Archives

Categories

Grab Your Copy Of The BikeAdvice Buyer's Guide!